TRNA Pseudouridine
   HOME

TheInfoList



OR:

Transfer ribonucleic acid (tRNA), formerly referred to as soluble ribonucleic acid (sRNA), is an adaptor
molecule A molecule is a group of two or more atoms that are held together by Force, attractive forces known as chemical bonds; depending on context, the term may or may not include ions that satisfy this criterion. In quantum physics, organic chemi ...
composed of
RNA Ribonucleic acid (RNA) is a polymeric molecule that is essential for most biological functions, either by performing the function itself (non-coding RNA) or by forming a template for the production of proteins (messenger RNA). RNA and deoxyrib ...
, typically 76 to 90
nucleotides Nucleotides are Organic compound, organic molecules composed of a nitrogenous base, a pentose sugar and a phosphate. They serve as monomeric units of the nucleic acid polymers – deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), both o ...
in length (in eukaryotes). In a
cell Cell most often refers to: * Cell (biology), the functional basic unit of life * Cellphone, a phone connected to a cellular network * Clandestine cell, a penetration-resistant form of a secret or outlawed organization * Electrochemical cell, a de ...
, it provides the physical link between the
genetic code Genetic code is a set of rules used by living cell (biology), cells to Translation (biology), translate information encoded within genetic material (DNA or RNA sequences of nucleotide triplets or codons) into proteins. Translation is accomplished ...
in
messenger RNA In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of synthesizing a protein. mRNA is created during the ...
(mRNA) and the
amino acid Amino acids are organic compounds that contain both amino and carboxylic acid functional groups. Although over 500 amino acids exist in nature, by far the most important are the 22 α-amino acids incorporated into proteins. Only these 22 a ...
sequence of proteins, carrying the correct sequence of amino acids to be combined by the protein-synthesizing machinery, the
ribosome Ribosomes () are molecular machine, macromolecular machines, found within all cell (biology), cells, that perform Translation (biology), biological protein synthesis (messenger RNA translation). Ribosomes link amino acids together in the order s ...
. Each three-nucleotide
codon Genetic code is a set of rules used by living cells to translate information encoded within genetic material (DNA or RNA sequences of nucleotide triplets or codons) into proteins. Translation is accomplished by the ribosome, which links prote ...
in mRNA is complemented by a three-nucleotide
anticodon Transfer ribonucleic acid (tRNA), formerly referred to as soluble ribonucleic acid (sRNA), is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes). In a cell, it provides the physical link between the gene ...
in tRNA. As such, tRNAs are a necessary component of
translation Translation is the communication of the semantics, meaning of a #Source and target languages, source-language text by means of an Dynamic and formal equivalence, equivalent #Source and target languages, target-language text. The English la ...
, the biological synthesis of new
protein Proteins are large biomolecules and macromolecules that comprise one or more long chains of amino acid residue (biochemistry), residues. Proteins perform a vast array of functions within organisms, including Enzyme catalysis, catalysing metab ...
s in accordance with the genetic code.


Overview

The process of
translation Translation is the communication of the semantics, meaning of a #Source and target languages, source-language text by means of an Dynamic and formal equivalence, equivalent #Source and target languages, target-language text. The English la ...
starts with the information stored in the nucleotide sequence of
DNA Deoxyribonucleic acid (; DNA) is a polymer composed of two polynucleotide chains that coil around each other to form a double helix. The polymer carries genetic instructions for the development, functioning, growth and reproduction of al ...
. This is first transformed into mRNA, then tRNA specifies which three-nucleotide codon from the genetic code corresponds to which amino acid. Each mRNA codon is recognized by a particular type of tRNA, which docks to it along a three-nucleotide
anticodon Transfer ribonucleic acid (tRNA), formerly referred to as soluble ribonucleic acid (sRNA), is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes). In a cell, it provides the physical link between the gene ...
, and together they form three
complementary Complement may refer to: The arts * Complement (music), an interval that, when added to another, spans an octave ** Aggregate complementation, the separation of pitch-class collections into complementary sets * Complementary color, in the visu ...
base pair A base pair (bp) is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases bound to each other by hydrogen bonds. They form the building blocks of the DNA double helix and contribute to the folded structure of both DNA ...
s. On the other end of the tRNA is a covalent attachment to the amino acid corresponding to the anticodon sequence, with each type of tRNA attaching to a specific amino acid. Because the genetic code contains multiple codons that specify the same amino acid, there are several tRNA molecules bearing different anticodons which carry the same amino acid. The covalent attachment to the tRNA
3' end Directionality, in molecular biology and biochemistry, is the end-to-end chemical orientation of a single strand of nucleic acid. In a single strand of DNA or RNA, the chemical convention of naming carbon atoms in the nucleotide pentose-sugar-ri ...
is catalysed by enzymes called
aminoacyl tRNA synthetase An aminoacyl-tRNA synthetase (aaRS or ARS), also called tRNA-ligase, is an enzyme that attaches the appropriate amino acid onto its corresponding tRNA. It does so by catalyzing the transesterification of a specific cognate amino acid or its pre ...
s. During protein synthesis, tRNAs with attached amino acids are delivered to the
ribosome Ribosomes () are molecular machine, macromolecular machines, found within all cell (biology), cells, that perform Translation (biology), biological protein synthesis (messenger RNA translation). Ribosomes link amino acids together in the order s ...
by proteins called
elongation factor Elongation factors are a set of proteins that function at the ribosome, during protein synthesis, to facilitate translational elongation from the formation of the first to the last peptide bond of a growing polypeptide. Most common elongation ...
s, which aid in association of the tRNA with the ribosome, synthesis of the new polypeptide, and translocation (movement) of the ribosome along the mRNA. If the tRNA's anticodon matches the mRNA, another tRNA already bound to the ribosome transfers the growing polypeptide chain from its 3' end to the amino acid attached to the 3' end of the newly delivered tRNA, a reaction catalyzed by the ribosome. A large number of the individual nucleotides in a tRNA molecule may be chemically modified, often by
methylation Methylation, in the chemistry, chemical sciences, is the addition of a methyl group on a substrate (chemistry), substrate, or the substitution of an atom (or group) by a methyl group. Methylation is a form of alkylation, with a methyl group replac ...
or
deamidation Deamidation is a chemical reaction in which an amide functional group in the side chain of the amino acids asparagine or glutamine is removed or converted to another functional group. Typically, asparagine is converted to aspartic acid or isoasp ...
. These unusual bases sometimes affect the tRNA's interaction with
ribosome Ribosomes () are molecular machine, macromolecular machines, found within all cell (biology), cells, that perform Translation (biology), biological protein synthesis (messenger RNA translation). Ribosomes link amino acids together in the order s ...
s and sometimes occur in the
anticodon Transfer ribonucleic acid (tRNA), formerly referred to as soluble ribonucleic acid (sRNA), is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes). In a cell, it provides the physical link between the gene ...
to alter base-pairing properties. The addition of a guanine nucleotide at the -1 position (G-1) to the 5′ end of tRNA-His, catalyzed by tRNA-His guanylyltransferase (Thg1) and Thg1-like proteins (TLPs) is particularly notable as it proceeds in the 3′ to 5′ direction, which is opposite to the canonical 5′ to 3′ nucleotide addition used by all other known nucleic acid polymerases. This reverse polymerization mechanism is biochemically unique and evolutionarily conserved, highlighting its fundamental importance in tRNA maturation. Homologs of Thg1 are found in all domains of life, where they can also participate in tRNA repair and quality control. The presence of G-1 is a key identity element for tRNA-His, and its absence severely impairs histidylation efficiency and tRNA function.


Structure

The structure of tRNA can be decomposed into its
primary structure Protein primary structure is the linear sequence of amino acids in a peptide or protein. By convention, the primary structure of a protein is reported starting from the amino-terminal (N) end to the carboxyl-terminal (C) end. Protein biosynthe ...
, its
secondary structure Protein secondary structure is the local spatial conformation of the polypeptide backbone excluding the side chains. The two most common Protein structure#Secondary structure, secondary structural elements are alpha helix, alpha helices and beta ...
(usually visualized as the ''cloverleaf structure''), and its
tertiary structure Protein tertiary structure is the three-dimensional shape of a protein. The tertiary structure will have a single polypeptide chain "backbone" with one or more protein secondary structures, the protein domains. Amino acid side chains and the ...
(all tRNAs have a similar L-shaped 3D structure that allows them to fit into the P and A sites of the
ribosome Ribosomes () are molecular machine, macromolecular machines, found within all cell (biology), cells, that perform Translation (biology), biological protein synthesis (messenger RNA translation). Ribosomes link amino acids together in the order s ...
). The cloverleaf structure becomes the 3D L-shaped structure through coaxial stacking of the helices, which is a common
RNA tertiary structure Nucleic acid tertiary structure is the Biomolecular structure#Tertiary structure, three-dimensional shape of a nucleic acid polymer. RNA and DNA molecules are capable of diverse functions ranging from molecular recognition to catalysis. Such fun ...
motif. The lengths of each arm, as well as the loop 'diameter', in a tRNA molecule vary from species to species. The tRNA structure consists of the following: * The acceptor stem is a 7- to 9-base pair (bp) stem made by the base pairing of the 5′-terminal nucleotide with the 3′-terminal nucleotide (which contains the CCA tail used to attach the amino acid). The acceptor stem may contain non-Watson-Crick base pairs. * The CCA tail is a
cytosine Cytosine () (symbol C or Cyt) is one of the four nucleotide bases found in DNA and RNA, along with adenine, guanine, and thymine ( uracil in RNA). It is a pyrimidine derivative, with a heterocyclic aromatic ring and two substituents attac ...
-cytosine-
adenine Adenine (, ) (nucleoside#List of nucleosides and corresponding nucleobases, symbol A or Ade) is a purine nucleotide base that is found in DNA, RNA, and Adenosine triphosphate, ATP. Usually a white crystalline subtance. The shape of adenine is ...
sequence at the 3′ end of the tRNA molecule. The amino acid loaded onto the tRNA by
aminoacyl tRNA synthetase An aminoacyl-tRNA synthetase (aaRS or ARS), also called tRNA-ligase, is an enzyme that attaches the appropriate amino acid onto its corresponding tRNA. It does so by catalyzing the transesterification of a specific cognate amino acid or its pre ...
s, to form
aminoacyl-tRNA Aminoacyl-tRNA (also aa-tRNA or charged tRNA) is tRNA to which its cognate amino acid is chemically bonded (charged). The aa-tRNA, along with particular elongation factors, deliver the amino acid to the ribosome for incorporation into the polyp ...
, is covalently bonded to the 3′-hydroxyl group on the CCA tail. This sequence is important for the recognition of tRNA by enzymes and critical in translation. In prokaryotes, the CCA sequence is transcribed in some tRNA sequences. In most prokaryotic tRNAs and eukaryotic tRNAs, the CCA sequence is added during processing and therefore does not appear in the tRNA gene. * The D loop is a 4- to 6-bp stem ending in a loop that often contains
dihydrouridine Dihydrouridine (abbreviated as D, DHU, or UH2) is a pyrimidine nucleoside which is the result of adding two hydrogen atoms to a uridine, making it a fully saturated pyrimidine ring with no remaining double bonds. D is found in tRNA and rRNA molec ...
. * The anticodon loop is a 5-bp stem whose loop contains the
anticodon Transfer ribonucleic acid (tRNA), formerly referred to as soluble ribonucleic acid (sRNA), is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes). In a cell, it provides the physical link between the gene ...
. * The TΨC loop is named so because of the characteristic presence of the unusual base Ψ in the loop, where Ψ is
pseudouridine Pseudouridine (5-ribosyluracil, abbreviated by the Greek letter psi- Ψ) is an isomer of the nucleoside uridine in which the uracil is attached via a carbon-carbon instead of a nitrogen-carbon glycosidic bond. Pseudouridine is the most abundant ...
, a modified
uridine Uridine (symbol U or Urd) is a glycosylated pyrimidine analog containing uracil attached to a ribose ring (or more specifically, a ribofuranose) via a β-N1- glycosidic bond. The analog is one of the five standard nucleosides which make up nuc ...
. The modified base is often found within the sequence 5'-TΨCGA-3', with the T (
ribothymidine The chemical compound 5-methyluridine (symbol m5U or m5U), also called ribothymidine (rT), is a pyrimidine nucleoside. It is the ribonucleoside counterpart to the deoxyribonucleoside thymidine, which lacks a hydroxyl group at the 2' position. 5 ...
, m5U) and A forming a base pair. * The variable loop or ''V loop'' sits between the anticodon loop and the ΨU loop and, as its name implies, varies in size from 3 to 21 bases. In some tRNAs, the "loop" is long enough to form a rigid stem, the ''variable arm''. tRNAs with a V loop more than 10 bases long is classified as "class II" and the rest is called "class I".


Anticodon

An anticodon is a unit of three
nucleotides Nucleotides are Organic compound, organic molecules composed of a nitrogenous base, a pentose sugar and a phosphate. They serve as monomeric units of the nucleic acid polymers – deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), both o ...
corresponding to the three bases of an
mRNA In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of Protein biosynthesis, synthesizing a protein. mRNA is ...
codon Genetic code is a set of rules used by living cells to translate information encoded within genetic material (DNA or RNA sequences of nucleotide triplets or codons) into proteins. Translation is accomplished by the ribosome, which links prote ...
. Each tRNA has a distinct anticodon triplet sequence that can form 3
complementary Complement may refer to: The arts * Complement (music), an interval that, when added to another, spans an octave ** Aggregate complementation, the separation of pitch-class collections into complementary sets * Complementary color, in the visu ...
base pair A base pair (bp) is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases bound to each other by hydrogen bonds. They form the building blocks of the DNA double helix and contribute to the folded structure of both DNA ...
s to one or more codons for an amino acid. Some anticodons pair with more than one codon due to
wobble base pair A wobble base pair is a pairing between two nucleotides in RNA molecules that does not follow Watson-Crick base pair rules. The four main wobble base pairs are guanine-uracil (G-U), hypoxanthine-uracil (I-U), hypoxanthine-adenine (I-A), and hypo ...
ing. Frequently, the first nucleotide of the anticodon is one not found on mRNA:
inosine Inosine is a nucleoside that is formed when hypoxanthine is attached to a ribose ring (also known as a ribofuranose) via a β-N9-glycosidic bond. It was discovered in 1965 in analysis of RNA transferase. Inosine is commonly found in tRNAs and is ...
, which can
hydrogen bond In chemistry, a hydrogen bond (H-bond) is a specific type of molecular interaction that exhibits partial covalent character and cannot be described as a purely electrostatic force. It occurs when a hydrogen (H) atom, Covalent bond, covalently b ...
to more than one base in the corresponding codon position. In
genetic code Genetic code is a set of rules used by living cell (biology), cells to Translation (biology), translate information encoded within genetic material (DNA or RNA sequences of nucleotide triplets or codons) into proteins. Translation is accomplished ...
, it is common for a single amino acid to be specified by all four third-position possibilities, or at least by both
pyrimidine Pyrimidine (; ) is an aromatic, heterocyclic, organic compound similar to pyridine (). One of the three diazines (six-membered heterocyclics with two nitrogen atoms in the ring), it has nitrogen atoms at positions 1 and 3 in the ring. The oth ...
s and
purine Purine is a heterocyclic aromatic organic compound that consists of two rings (pyrimidine and imidazole) fused together. It is water-soluble. Purine also gives its name to the wider class of molecules, purines, which include substituted puri ...
s; for example, the amino acid
glycine Glycine (symbol Gly or G; ) is an amino acid that has a single hydrogen atom as its side chain. It is the simplest stable amino acid. Glycine is one of the proteinogenic amino acids. It is encoded by all the codons starting with GG (G ...
is coded for by the codon sequences GGU, GGC, GGA, and GGG. Other modified nucleotides may also appear at the first anticodon position—sometimes known as the "wobble position"—resulting in subtle changes to the genetic code, as for example in
mitochondria A mitochondrion () is an organelle found in the cells of most eukaryotes, such as animals, plants and fungi. Mitochondria have a double membrane structure and use aerobic respiration to generate adenosine triphosphate (ATP), which is us ...
. The possibility of wobble bases reduces the number of tRNA types required: instead of 61 types with one for each sense codon of the standard genetic code), only 31 tRNAs are required to translate, unambiguously, all 61 sense codons.


Nomenclature

A tRNA is commonly named by its intended amino acid (e.g. ), by its anticodon sequence (e.g. ), or by both (e.g. or ). These two features describe the main function of the tRNA, but do not actually cover the whole diversity of tRNA variation; as a result, numerical suffixes are added to differentiate. tRNAs intended for the same amino acid are called "isotypes"; these with the same anticodon sequence are called "isoacceptors"; and these with both being the same but differing in other places are called "isodecoders".


Aminoacylation

Aminoacylation Aminoacylation is the process of adding an aminoacyl group to a compound. See also * Acylation * tRNA aminoacylation * Transfer RNA-like structures References Organic reactions {{Reaction-stub ...
is the process of adding an aminoacyl group to a compound. It covalently links an
amino acid Amino acids are organic compounds that contain both amino and carboxylic acid functional groups. Although over 500 amino acids exist in nature, by far the most important are the 22 α-amino acids incorporated into proteins. Only these 22 a ...
to the CCA 3′ end of a tRNA molecule. Each tRNA is aminoacylated (or ''charged'') with a specific amino acid by an
aminoacyl tRNA synthetase An aminoacyl-tRNA synthetase (aaRS or ARS), also called tRNA-ligase, is an enzyme that attaches the appropriate amino acid onto its corresponding tRNA. It does so by catalyzing the transesterification of a specific cognate amino acid or its pre ...
. There is normally a single aminoacyl tRNA synthetase for each amino acid, despite the fact that there can be more than one tRNA, and more than one anticodon for an amino acid. Recognition of the appropriate tRNA by the synthetases is not mediated solely by the anticodon, and the acceptor stem often plays a prominent role. Reaction: # amino acid + ATP → aminoacyl-AMP +
PPi PPI may refer to: Science and technology Biochemistry * PPi, the anion P2O74−, a pyrophosphate * Polyproline I helix * Protein–protein interaction Medicine * Patient and public involvement * Prepulse inhibition, of a later pulse * Proton-pump ...
# aminoacyl-AMP + tRNA → aminoacyl-tRNA +
AMP Amp or AMP may refer to: * Ampere, a unit of electric current, often shortened to amp * Amplifier, a device that increases the amplitude of a signal Arts and entertainment Music * After Midnight Project, Los Angeles alternative rock band * A ...
Certain organisms can have one or more aminophosphate-tRNA synthetases missing. This leads to charging of the tRNA by a chemically related amino acid, and by use of an enzyme or enzymes, the tRNA is modified to be correctly charged. For example, ''
Helicobacter pylori ''Helicobacter pylori'', previously known as ''Campylobacter pylori'', is a gram-negative, Flagellum#bacterial, flagellated, Bacterial cellular morphologies#Helical, helical bacterium. Mutants can have a rod or curved rod shape that exhibits l ...
'' has glutaminyl tRNA synthetase missing. Thus, glutamate tRNA synthetase charges tRNA-glutamine(tRNA-Gln) with
glutamate Glutamic acid (symbol Glu or E; known as glutamate in its anionic form) is an α-amino acid that is used by almost all living beings in the biosynthesis of proteins. It is a Essential amino acid, non-essential nutrient for humans, meaning that ...
. An amidotransferase then converts the acid side chain of the glutamate to the amide, forming the correctly charged gln-tRNA-Gln.


Binding to ribosome

The
ribosome Ribosomes () are molecular machine, macromolecular machines, found within all cell (biology), cells, that perform Translation (biology), biological protein synthesis (messenger RNA translation). Ribosomes link amino acids together in the order s ...
has three binding sites for tRNA molecules that span the space between the two ribosomal subunits: the A (aminoacyl), P (peptidyl), and E (exit) sites. In addition, the ribosome has two other sites for tRNA binding that are used during
mRNA In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of Protein biosynthesis, synthesizing a protein. mRNA is ...
decoding or during the initiation of
protein synthesis Protein biosynthesis, or protein synthesis, is a core biological process, occurring inside cells, balancing the loss of cellular proteins (via degradation or export) through the production of new proteins. Proteins perform a number of critica ...
. These are the T site (named elongation factor Tu) and I site (initiation). By convention, the tRNA binding sites are denoted with the site on the small ribosomal subunit listed first and the site on the large ribosomal subunit listed second. For example, the A site is often written A/A, the P site, P/P, and the E site, E/E. The binding proteins like L27, L2, L14, L15, L16 at the A- and P- sites have been determined by affinity labeling by A. P. Czernilofsky et al. (''Proc. Natl. Acad. Sci, USA'', pp. 230–234, 1974). Once translation initiation is complete, the first aminoacyl tRNA is located in the P/P site, ready for the elongation cycle described below. During translation elongation, tRNA first binds to the ribosome as part of a complex with elongation factor Tu (
EF-Tu EF-Tu (elongation factor thermo unstable) is a prokaryotic elongation factor responsible for catalyzing the binding of an aminoacyl-tRNA (aa-tRNA) to the ribosome. It is a G-protein, and facilitates the selection and binding of an aa-tRNA to t ...
) or its eukaryotic (
eEF-1 eEF-1 are two eukaryotic elongation factors. It forms two complexes, the EF-Tu homolog EF-1A and the EF-Ts homolog EF-1B, the former's guanide exchange factor. Both are also found in archaea. Structure The nomenclature for the eEF-1 subuni ...
) or archaeal counterpart. This initial tRNA binding site is called the A/T site. In the A/T site, the A-site half resides in the small ribosomal subunit where the mRNA decoding site is located. The mRNA decoding site is where the
mRNA In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of Protein biosynthesis, synthesizing a protein. mRNA is ...
codon Genetic code is a set of rules used by living cells to translate information encoded within genetic material (DNA or RNA sequences of nucleotide triplets or codons) into proteins. Translation is accomplished by the ribosome, which links prote ...
is read out during translation. The T-site half resides mainly on the large ribosomal subunit where EF-Tu or eEF-1 interacts with the ribosome. Once mRNA decoding is complete, the aminoacyl-tRNA is bound in the A/A site and is ready for the next
peptide bond In organic chemistry, a peptide bond is an amide type of covalent chemical bond linking two consecutive alpha-amino acids from C1 (carbon number one) of one alpha-amino acid and N2 (nitrogen number two) of another, along a peptide or protein cha ...
to be formed to its attached amino acid. The peptidyl-tRNA, which transfers the growing polypeptide to the aminoacyl-tRNA bound in the A/A site, is bound in the P/P site. Once the peptide bond is formed, the tRNA in the P/P site is acylated, or has a free 3' end, and the tRNA in the A/A site dissociates the growing polypeptide chain. To allow for the next elongation cycle, the tRNAs then move through hybrid A/P and P/E binding sites, before completing the cycle and residing in the P/P and E/E sites. Once the A/A and P/P tRNAs have moved to the P/P and E/E sites, the mRNA has also moved over by one
codon Genetic code is a set of rules used by living cells to translate information encoded within genetic material (DNA or RNA sequences of nucleotide triplets or codons) into proteins. Translation is accomplished by the ribosome, which links prote ...
and the A/T site is vacant, ready for the next round of mRNA decoding. The tRNA bound in the E/E site then leaves the ribosome. The P/I site is actually the first to bind to aminoacyl tRNA, which is delivered by an initiation factor called IF2 in bacteria. However, the existence of the P/I site in eukaryotic or archaeal
ribosome Ribosomes () are molecular machine, macromolecular machines, found within all cell (biology), cells, that perform Translation (biology), biological protein synthesis (messenger RNA translation). Ribosomes link amino acids together in the order s ...
s has not yet been confirmed. The P-site protein L27 has been determined by affinity labeling by E. Collatz and A. P. Czernilofsky (''FEBS Lett.'', Vol. 63, pp. 283–286, 1976).


tRNA genes

Organisms vary in the number of tRNA
genes In biology, the word gene has two meanings. The Mendelian gene is a basic unit of heredity. The molecular gene is a sequence of nucleotides in DNA that is transcribed to produce a functional RNA. There are two types of molecular genes: protei ...
in their
genome A genome is all the genetic information of an organism. It consists of nucleotide sequences of DNA (or RNA in RNA viruses). The nuclear genome includes protein-coding genes and non-coding genes, other functional regions of the genome such as ...
. For example, the
nematode The nematodes ( or ; ; ), roundworms or eelworms constitute the phylum Nematoda. Species in the phylum inhabit a broad range of environments. Most species are free-living, feeding on microorganisms, but many are parasitic. Parasitic worms (h ...
worm ''
C. elegans ''Caenorhabditis elegans'' () is a free-living transparent nematode about 1 mm in length that lives in temperate soil environments. It is the type species of its genus. The name is a blend of the Greek ''caeno-'' (recent), ''rhabditis'' ( ...
'', a commonly used model organism in
genetics Genetics is the study of genes, genetic variation, and heredity in organisms.Hartl D, Jones E (2005) It is an important branch in biology because heredity is vital to organisms' evolution. Gregor Mendel, a Moravian Augustinians, Augustinian ...
studies, has 29,647 genes in its
nuclear Nuclear may refer to: Physics Relating to the nucleus of the atom: *Nuclear engineering *Nuclear physics *Nuclear power *Nuclear reactor *Nuclear weapon *Nuclear medicine *Radiation therapy *Nuclear warfare Mathematics * Nuclear space *Nuclear ...
genome, of which 620 code for tRNA. The budding yeast ''
Saccharomyces cerevisiae ''Saccharomyces cerevisiae'' () (brewer's yeast or baker's yeast) is a species of yeast (single-celled fungal microorganisms). The species has been instrumental in winemaking, baking, and brewing since ancient times. It is believed to have be ...
'' has 275 tRNA genes in its genome. The number of tRNA genes per genome can vary widely, with bacterial species from groups such as Fusobacteria and Tenericutes having around 30 genes per genome while complex eukaryotic genomes such as the zebrafish (''Danio rerio'') can bear more than 10 thousand tRNA genes. In the human genome, which, according to January 2013 estimates, has about 20,848 protein coding genes in total, there are 497 nuclear genes encoding cytoplasmic tRNA molecules, and 324 tRNA-derived
pseudogenes Pseudogenes are nonfunctional segments of DNA that resemble functional genes. Pseudogenes can be formed from both protein-coding genes and non-coding genes. In the case of protein-coding genes, most pseudogenes arise as superfluous copies of fun ...
—tRNA genes thought to be no longer functional (although pseudo tRNAs have been shown to be involved in
antibiotic resistance Antimicrobial resistance (AMR or AR) occurs when microbes evolve mechanisms that protect them from antimicrobials, which are drugs used to treat infections. This resistance affects all classes of microbes, including bacteria (antibiotic resis ...
in bacteria). As with all eukaryotes, there are 22
mitochondria A mitochondrion () is an organelle found in the cells of most eukaryotes, such as animals, plants and fungi. Mitochondria have a double membrane structure and use aerobic respiration to generate adenosine triphosphate (ATP), which is us ...
l tRNA genes in humans. Mutations in some of these genes have been associated with severe diseases like the
MELAS syndrome MELAS (Mitochondrial Encephalopathy, Lactic Acidosis, and Stroke-like episodes) is one of the family of mitochondrial diseases, which also include MIDD (maternally inherited diabetes and deafness), MERRF syndrome, and Leber's hereditary opti ...
. Regions in nuclear
chromosomes A chromosome is a package of DNA containing part or all of the genetic material of an organism. In most chromosomes, the very long thin DNA fibers are coated with nucleosome-forming packaging proteins; in eukaryotic cells, the most importa ...
, very similar in sequence to mitochondrial tRNA genes, have also been identified (tRNA-lookalikes). These tRNA-lookalikes are also considered part of the nuclear mitochondrial DNA (genes transferred from the mitochondria to the nucleus). The phenomenon of multiple nuclear copies of mitochondrial tRNA (tRNA-lookalikes) has been observed in many higher organisms from human to the opossum suggesting the possibility that the lookalikes are functional. Cytoplasmic tRNA genes can be grouped into 49 families according to their anticodon features. These genes are found on all chromosomes, except the 22 and Y chromosome. High clustering on 6p is observed (140 tRNA genes), as well as on chromosome 1. The
HGNC The HUGO Gene Nomenclature Committee (HGNC) is a committee of the Human Genome Organisation (HUGO) that sets the standardization, standards for human gene nomenclature. The HGNC approves a ''unique'' and ''meaningful'' name for every known human g ...
, in collaboration with the Genomic tRNA Database
GtRNAdb
and experts in the field, has approved unique names for human genes that encode tRNAs. Typically, tRNAs genes from Bacteria are shorter (mean = 77.6 bp) than tRNAs from Archaea (mean = 83.1 bp) and eukaryotes (mean = 84.7 bp). The mature tRNA follows an opposite pattern with tRNAs from Bacteria being usually longer (median = 77.6 nt) than tRNAs from Archaea (median = 76.8 nt), with eukaryotes exhibiting the shortest mature tRNAs (median = 74.5 nt).


Evolution

Genomic tRNA content is a differentiating feature of genomes among biological domains of life: Archaea present the simplest situation in terms of genomic tRNA content with a uniform number of gene copies, Bacteria have an intermediate situation and Eukarya present the most complex situation. Eukarya present not only more tRNA gene content than the other two kingdoms but also a high variation in gene copy number among different isoacceptors, and this complexity seem to be due to duplications of tRNA genes and changes in anticodon specificity . Evolution of the tRNA gene copy number across different species has been linked to the appearance of specific tRNA modification enzymes (uridine methyltransferases in Bacteria, and adenosine deaminases in Eukarya), which increase the decoding capacity of a given tRNA. As an example, tRNAAla encodes four different tRNA isoacceptors (AGC, UGC, GGC and CGC). In Eukarya, AGC isoacceptors are extremely enriched in gene copy number in comparison to the rest of isoacceptors, and this has been correlated with its A-to-I modification of its wobble base. This same trend has been shown for most amino acids of eukaryal species. Indeed, the effect of these two tRNA modifications is also seen in
codon usage bias Codon usage bias refers to differences in the frequency of occurrence of synonymous codons in coding DNA. A codon is a series of three nucleotides (a triplet) that encodes a specific amino acid residue in a polypeptide chain or for the termination ...
. Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified tRNAs, which suggests a possible role of these codons—and consequently of these tRNA modifications—in translation efficiency. Many species have lost specific tRNAs during evolution. For instance, both mammals and birds lack the same 14 out of the possible 64 tRNA genes, but other life forms contain these tRNAs. For translating codons for which an exactly pairing tRNA is missing, organisms resort to a strategy called wobbling, in which imperfectly matched tRNA/mRNA pairs still give rise to translation, although this strategy also increases the propensity for translation errors. The reasons why tRNA genes have been lost during evolution remains under debate but may relate improving resistance to viral infection. Because nucleotide triplets can present more combinations than there are amino acids and associated tRNAs, there is redundancy in the genetic code, and several different 3-nucleotide codons can express the same amino acid. This codon bias is what necessitates codon optimization.


Hypothetical origin

The top half of tRNA (consisting of the T arm and the acceptor stem with 5′-terminal phosphate group and 3′-terminal CCA group) and the bottom half (consisting of the D arm and the anticodon arm) are independent units in structure as well as in function. The top half may have evolved first including the 3′-terminal genomic tag which originally may have marked tRNA-like molecules for replication in early
RNA world The RNA world is a hypothetical stage in the evolutionary history of life on Earth in which self-replicating RNA molecules proliferated before the evolution of DNA and proteins. The term also refers to the hypothesis that posits the existence ...
. The bottom half may have evolved later as an expansion, e.g. as protein synthesis started in RNA world and turned it into a ribonucleoprotein world ( RNP world). This proposed scenario is called
genomic tag hypothesis Genomics is an interdisciplinary field of molecular biology focusing on the structure, function, evolution, mapping, and editing of genomes. A genome is an organism's complete set of DNA, including all of its genes as well as its hierarchical, ...
. In fact, tRNA and tRNA-like aggregates have an important catalytic influence (i.e., as
ribozyme Ribozymes (ribonucleic acid enzymes) are RNA molecules that have the ability to Catalysis, catalyze specific biochemical reactions, including RNA splicing in gene expression, similar to the action of protein enzymes. The 1982 discovery of ribozy ...
s) on replication still today. These roles may be regarded as ' molecular (or chemical) fossils' of RNA world. In March 2021, researchers reported evidence suggesting that an early form of transfer RNA could have been a replicator
ribozyme Ribozymes (ribonucleic acid enzymes) are RNA molecules that have the ability to Catalysis, catalyze specific biochemical reactions, including RNA splicing in gene expression, similar to the action of protein enzymes. The 1982 discovery of ribozy ...
molecule in the very early development of life, or
abiogenesis Abiogenesis is the natural process by which life arises from non-living matter, such as simple organic compounds. The prevailing scientific hypothesis is that the transition from non-living to living entities on Earth was not a single even ...
. Evolution of type I and type II tRNAs is explained to the last nucleotide by the three 31 nucleotide minihelix tRNA evolution theorem, which also describes the pre-life to life transition on Earth. Three 31 nucleotide minihelices of known sequence were ligated in pre-life to generate a 93 nucleotide tRNA precursor. In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA “elbow” (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.


tRNA-derived fragments

tRNA-derived fragments (or tRFs) are short molecules that emerge after cleavage of the mature tRNAs or the precursor transcript. Both cytoplasmic and mitochondrial tRNAs can produce fragments. There are at least four structural types of tRFs believed to originate from mature tRNAs, including the relatively long tRNA halves and short 5'-tRFs, 3'-tRFs and i-tRFs. The precursor tRNA can be cleaved to produce molecules from the 5' leader or 3' trail sequences. Cleavage enzymes include Angiogenin, Dicer, RNase Z and RNase P. Especially in the case of Angiogenin, the tRFs have a characteristically unusual cyclic phosphate at their 3' end and a hydroxyl group at the 5' end. tRFs appear to play a role in
RNA interference RNA interference (RNAi) is a biological process in which RNA molecules are involved in sequence-specific suppression of gene expression by double-stranded RNA, through translational or transcriptional repression. Historically, RNAi was known by ...
, specifically in the suppression of retroviruses and retrotransposons that use tRNA as a primer for replication. Half-tRNAs cleaved by
angiogenin Angiogenin (ANG) also known as ribonuclease 5 is a small 123 amino acid protein that in humans is encoded by the ''ANG'' gene. Angiogenin is a potent stimulator of new blood vessels through the process of angiogenesis. Ang hydrolyzes cellular R ...
are also known as tiRNAs. The biogenesis of smaller fragments, including those that function as
piRNA Pirna (; , ) is a town in Saxony, Germany and capital of the administrative district Sächsische Schweiz-Osterzgebirge. The town's population is over 37,000. Pirna is located near Dresden and is an important district town as well as a ''Große ...
s, are less understood. tRFs have multiple dependencies and roles; such as exhibiting significant changes between sexes, among races and disease status. Functionally, they can be loaded on Ago and act through RNAi pathways, participate in the formation of stress granules, displace mRNAs from RNA-binding proteins or inhibit translation. At the system or the organismal level, the four types of tRFs have a diverse spectrum of activities. Functionally, tRFs are associated with viral infection, cancer, cell proliferation and also with epigenetic transgenerational regulation of metabolism. tRFs are not restricted to humans and have been shown to exist in multiple organisms. Two online tools are available for those wishing to learn more about tRFs: the framework for the interactive exploration of mitochondrial and nuclear tRNA fragments
MINTbase
and the relational database of Transfer RNA related Fragments
tRFdb
. MINTbase also provides a naming scheme for the naming of tRFs calle
tRF-license plates
(or MINTcodes) that is genome independent; the scheme compresses an RNA sequence into a shorter string.


Engineered tRNAs

tRNAs with modified anticodons and/or acceptor stems can be used to modify the genetic code. Scientists have successfully repurposed codons (sense and stop) to accept amino acids (natural and novel), for both initiation (see:
start codon The start codon is the first codon of a messenger RNA (mRNA) transcript translated by a ribosome. The start codon always codes for methionine in eukaryotes and archaea and a ''N''-formylmethionine (fMet) in bacteria, mitochondria and plastids. ...
) and elongation. In 1990, tRNA (modified from the tRNA gen
metY
was inserted into ''E. coli'', causing it to initiate protein synthesis at the UAG stop codon, as long as it is preceded by a strong Shine-Dalgarno sequence. At initiation it not only inserts the traditional
formylmethionine ''N''-Formylmethionine (fMet, HCO-Met, For-Met) is a derivative of the amino acid methionine in which a formyl group has been added to the amino group. It is specifically used for initiation of protein synthesis from bacterial and organellar g ...
, but also formylglutamine, as glutamyl-tRNA synthase also recognizes the new tRNA. The experiment was repeated in 1993, now with an elongator tRNA modified to be recognized by the
methionyl-tRNA formyltransferase In enzymology, a methionyl-tRNA formyltransferase () is an enzyme that catalyzes the chemical reaction : 10-formyltetrahydrofolate + L-methionyl-tRNAfMet + H2O \rightleftharpoons tetrahydrofolate + ''N''-formylmethionyl-tRNAfMet This enzyme b ...
. A similar result was obtained in ''
Mycobacterium ''Mycobacterium'' is a genus of over 190 species in the phylum Actinomycetota, assigned its own family, Mycobacteriaceae. This genus includes pathogens known to cause serious diseases in mammals, including tuberculosis (''Mycobacterium tuberculo ...
''. Later experiments showed that the new tRNA was orthogonal to the regular AUG start codon showing no detectable off-target translation initiation events in a genomically recoded ''E. coli'' strain.


tRNA biogenesis

In
eukaryotic The eukaryotes ( ) constitute the Domain (biology), domain of Eukaryota or Eukarya, organisms whose Cell (biology), cells have a membrane-bound cell nucleus, nucleus. All animals, plants, Fungus, fungi, seaweeds, and many unicellular organisms ...
cells, tRNAs are transcribed by
RNA polymerase III In eukaryote cells, RNA polymerase III (also called Pol III) is a protein that transcribes DNA to synthesize 5S ribosomal RNA, tRNA, and other small RNAs. The genes transcribed by RNA Pol III fall in the category of "housekeeping" genes whose ex ...
as pre-tRNAs in the nucleus. RNA polymerase III recognizes two highly conserved downstream promoter sequences: the 5′ intragenic control region (5′-ICR, D-control region, or A box), and the 3′-ICR (T-control region or B box) inside tRNA genes. The first promoter begins at +8 of mature tRNAs and the second promoter is located 30–60 nucleotides downstream of the first promoter. The transcription terminates after a stretch of four or more
thymidine Thymidine (nucleoside#List of nucleosides and corresponding nucleobases, symbol dT or dThd), also known as deoxythymidine, deoxyribosylthymine, or thymine deoxyriboside, is a pyrimidine nucleoside, deoxynucleoside. Deoxythymidine is the DNA nuc ...
s. Pre-tRNAs undergo extensive modifications inside the nucleus. Some pre-tRNAs contain
intron An intron is any nucleotide sequence within a gene that is not expressed or operative in the final RNA product. The word ''intron'' is derived from the term ''intragenic region'', i.e., a region inside a gene."The notion of the cistron .e., gen ...
s that are spliced, or cut, to form the functional tRNA molecule; in bacteria these self- splice, whereas in eukaryotes and
archaea Archaea ( ) is a Domain (biology), domain of organisms. Traditionally, Archaea only included its Prokaryote, prokaryotic members, but this has since been found to be paraphyletic, as eukaryotes are known to have evolved from archaea. Even thou ...
they are removed by tRNA-splicing
endonuclease In molecular biology, endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain (namely DNA or RNA). Some, such as deoxyribonuclease I, cut DNA relatively nonspecifically (with regard to sequence), while man ...
s. Eukaryotic pre-tRNA contains bulge-helix-bulge (BHB) structure motif that is important for recognition and precise splicing of tRNA intron by endonucleases. This motif position and structure are evolutionarily conserved. However, some organisms, such as unicellular algae have a non-canonical position of BHB-motif as well as 5′- and 3′-ends of the spliced intron sequence. The 5′ sequence is removed by
RNase P Ribonuclease P (, ''RNase P'') is a type of ribonuclease which cleaves RNA. RNase P is unique from other RNases in that it is a ribozyme – a ribonucleic acid that acts as a catalyst in the same way that a protein-based enzyme would. Its functio ...
, whereas the 3′ end is removed by the tRNase Z enzyme. A notable exception is in the
archaeon Archaea ( ) is a domain of organisms. Traditionally, Archaea only included its prokaryotic members, but this has since been found to be paraphyletic, as eukaryotes are known to have evolved from archaea. Even though the domain Archaea cladis ...
''
Nanoarchaeum equitans ''Nanoarchaeum equitans'' is a species of marine archaea that was discovered in 2002 in a hydrothermal vent off the coast of Iceland on the Kolbeinsey Ridge by Karl Stetter. It has been proposed as the first species in a new phylum, and is th ...
,'' which does not possess an RNase P enzyme and has a promoter placed such that transcription starts at the 5′ end of the mature tRNA. The non-templated 3′ CCA tail is added by a
nucleotidyl transferase Nucleotidyltransferases are transferase enzymes of phosphorus-containing groups, e.g., substituent In organic chemistry, a substituent is one or a group of atoms that replaces (one or more) atoms, thereby becoming a moiety in the resultant ( ...
. Before tRNAs are
exported An export in international trade is a good produced in one country that is sold into another country or a service provided in one country for a national or resident of another country. The seller of such goods or the service provider is a ...
into the
cytoplasm The cytoplasm describes all the material within a eukaryotic or prokaryotic cell, enclosed by the cell membrane, including the organelles and excluding the nucleus in eukaryotic cells. The material inside the nucleus of a eukaryotic cell a ...
by Los1/
Xpo-t Exportin-T is a protein that in humans is encoded by the ''XPOT'' gene. This gene encodes a protein belonging to the RAN-GTPase exportin family that mediates export of tRNA Transfer ribonucleic acid (tRNA), formerly referred to as soluble ribo ...
, tRNAs are aminoacylated. The order of the processing events is not conserved. For example, in
yeast Yeasts are eukaryotic, single-celled microorganisms classified as members of the fungus kingdom (biology), kingdom. The first yeast originated hundreds of millions of years ago, and at least 1,500 species are currently recognized. They are est ...
, the splicing is not carried out in the nucleus but at the cytoplasmic side of
mitochondria A mitochondrion () is an organelle found in the cells of most eukaryotes, such as animals, plants and fungi. Mitochondria have a double membrane structure and use aerobic respiration to generate adenosine triphosphate (ATP), which is us ...
l membranes.


History

The existence of tRNA was first hypothesized by
Francis Crick Francis Harry Compton Crick (8 June 1916 – 28 July 2004) was an English molecular biologist, biophysicist, and neuroscientist. He, James Watson, Rosalind Franklin, and Maurice Wilkins played crucial roles in deciphering the Nucleic acid doub ...
as the "
adaptor hypothesis The adaptor hypothesis is a theoretical scheme in molecular biology to explain how information encoded in the nucleic acid sequences of messenger RNA (mRNA) is used to specify the amino acids that make up proteins during the process of Translation ...
" based on the assumption that there must exist an adapter molecule capable of mediating the translation of the RNA alphabet into the protein alphabet.
Paul C Zamecnik Paul Charles Zamecnik (November 22, 1912 – October 27, 2009) was an American scientist who played a central role in the early history of molecular biology. He was a professor of medicine at Harvard Medical School and a senior scientist at Massa ...
,
Mahlon Hoagland Mahlon Bush Hoagland (October 5, 1921 – September 18, 2009) was an American biochemist who discovered transfer RNA (tRNA), the translator of the genetic code.Vicki GlaserMahlon Hoagland, RNA Expert, Dies at 87(obituary), ''New York Times'', ...
, and
Mary Louise Stephenson Mary may refer to: People * Mary (name), a female given name (includes a list of people with the name) Religion * New Testament people named Mary, overview article linking to many of those below * Mary, mother of Jesus, also called the Blesse ...
discovered tRNA. Significant research on structure was conducted in the early 1960s by
Alex Rich Alexander Rich (15 November 1924 – 27 April 2015) was an American biologist and biophysicist. He was the William Thompson Sedgwick Professor of Biophysics at MIT (since 1958) and Harvard Medical School. Rich earned an A.B. ('' magna cu ...
and
Donald Caspar Donald L. D. Caspar (January 8, 1927 – November 27, 2021) was an American structural biologist (the very term he coined) known for his works on the structures of biological molecules, particularly of the tobacco mosaic virus. He was an emeritu ...
, two researchers in Boston, the Jacques Fresco group in
Princeton University Princeton University is a private university, private Ivy League research university in Princeton, New Jersey, United States. Founded in 1746 in Elizabeth, New Jersey, Elizabeth as the College of New Jersey, Princeton is the List of Colonial ...
and a
United Kingdom The United Kingdom of Great Britain and Northern Ireland, commonly known as the United Kingdom (UK) or Britain, is a country in Northwestern Europe, off the coast of European mainland, the continental mainland. It comprises England, Scotlan ...
group at
King's College London King's College London (informally King's or KCL) is a public university, public research university in London, England. King's was established by royal charter in 1829 under the patronage of George IV of the United Kingdom, King George IV ...
. In 1965,
Robert W. Holley Robert William Holley (January 28, 1922 – February 11, 1993) was an American biochemist. He shared the Nobel Prize in Physiology or Medicine in 1968 (with Har Gobind Khorana and Marshall Warren Nirenberg) for describing the structure of alani ...
of
Cornell University Cornell University is a Private university, private Ivy League research university based in Ithaca, New York, United States. The university was co-founded by American philanthropist Ezra Cornell and historian and educator Andrew Dickson W ...
reported the primary structure and suggested three secondary structures. tRNA was first crystallized in Madison, Wisconsin, by Robert M. Bock. The cloverleaf structure was ascertained by several other studies in the following years and was finally confirmed using
X-ray crystallography X-ray crystallography is the experimental science of determining the atomic and molecular structure of a crystal, in which the crystalline structure causes a beam of incident X-rays to Diffraction, diffract in specific directions. By measuring th ...
studies in 1974. Two independent groups,
Kim Sung-Hou Kim Sung-Hou (; born 1937) is a Korean-born American structural biologist and biophysicist. Kim reported the first 3D structure of tRNA with A. Rich in 1973. He also published many papers on the structures of protein molecules including human R ...
working under
Alexander Rich Alexander Rich (15 November 1924 – 27 April 2015) was an American biologist and biophysicist. He was the William Thompson Sedgwick Professor of Biophysics at MIT (since 1958) and Harvard Medical School. Rich earned an A.B. ('' magna cum ...
and a British group headed by
Aaron Klug Sir Aaron Klug (11 August 1926 – 20 November 2018) was a British biophysicist and chemist. He was a winner of the 1982 Nobel Prize in Chemistry for his development of crystallographic electron microscopy and his structural elucidation of biol ...
, published the same crystallography findings within a year.


Clinical relevance

Interference with aminoacylation may be useful as an approach to treating some diseases: cancerous cells may be relatively vulnerable to disturbed aminoacylation compared to healthy cells. The protein synthesis associated with cancer and viral biology is often very dependent on specific tRNA molecules. For instance, for liver cancer charging tRNA-Lys-CUU with lysine sustains liver cancer cell growth and metastasis, whereas healthy cells have a much lower dependence on this tRNA to support cellular physiology. Similarly, hepatitis E virus requires a tRNA landscape that substantially differs from that associated with uninfected cells. Hence, inhibition of aminoacylation of specific tRNA species is considered a promising novel avenue for the rational treatment of a plethora of diseases.


See also

*
Cloverleaf model of tRNA The cloverleaf model of tRNA is a model that depicts the molecular structure of tRNA. The model revealed that the chain of tRNA consists of two ends—sometimes called "business ends"—and three arms. Two of the arms have a loop, D-loop (dihydro ...
*
Kim Sung-Hou Kim Sung-Hou (; born 1937) is a Korean-born American structural biologist and biophysicist. Kim reported the first 3D structure of tRNA with A. Rich in 1973. He also published many papers on the structures of protein molecules including human R ...
*
Kissing stem-loop In genetics, a kissing stem-loop, or kissing stem loop interaction, is formed in ribonucleic acid (RNA) when two bases between two hairpin loops pair. These intra- and intermolecular kissing interactions are important in forming the tertiary or ...
*
mRNA In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of Protein biosynthesis, synthesizing a protein. mRNA is ...
*
non-coding RNA A non-coding RNA (ncRNA) is a functional RNA molecule that is not Translation (genetics), translated into a protein. The DNA sequence from which a functional non-coding RNA is transcribed is often called an RNA gene. Abundant and functionally imp ...
and
intron An intron is any nucleotide sequence within a gene that is not expressed or operative in the final RNA product. The word ''intron'' is derived from the term ''intragenic region'', i.e., a region inside a gene."The notion of the cistron .e., gen ...
s *
Slippery sequence A slippery sequence is a small section of codon nucleotide sequences (usually UUUAAAC) that controls the rate and chance of ribosomal frameshifting. A slippery sequence causes a faster ribosomal transfer which in turn can cause the reading ribosom ...
*
tmRNA Transfer-messenger RNA (abbreviated tmRNA, also known as 10Sa RNA and by its genetic name SsrA) is a bacterial RNA molecule with dual tRNA-like and messenger RNA-like properties. The tmRNA forms a ribonucleoprotein complex (tmRNP) together with Sm ...
*
Transfer RNA-like structures Transfer RNA-like structures (tRNA-like structures) are RNA sequences, which have a similar tertiary structure to tRNA; they frequently contain a pseudoknot close to the 3' end. The presence of tRNA-like structures has been demonstrated in many pla ...
*
Translation Translation is the communication of the semantics, meaning of a #Source and target languages, source-language text by means of an Dynamic and formal equivalence, equivalent #Source and target languages, target-language text. The English la ...
*
tRNADB tRNAdb is a curated database of transfer RNA (tRNA) from Germany. the database contained over twelve thousand entries. It is not online as of 2025, hence the link to Internet Archive's version in the infobox. Databases with similar names tRN ...
*
Wobble hypothesis A wobble base pair is a pairing between two nucleotides in RNA molecules that does not follow Watson-Crick base pair rules. The four main wobble base pairs are guanine-uracil (G-U), hypoxanthine-uracil (I-U), hypoxanthine-adenine (I-A), and hypo ...
*
Aminoacyl-tRNA Aminoacyl-tRNA (also aa-tRNA or charged tRNA) is tRNA to which its cognate amino acid is chemically bonded (charged). The aa-tRNA, along with particular elongation factors, deliver the amino acid to the ribosome for incorporation into the polyp ...


References


External links


tRNAdb (updated and completely restructured version of Spritzls tRNA compilation)

tRNA surprising role in breast cancer growth

tRNA link to heart disease and stroke

GtRNAdb: Collection of tRNAs identified from complete genomes

HGNC: Gene nomenclature of human tRNAs

© RCSB Protein Data Bank
*

*

*


Rfam entry for tRNA
{{DEFAULTSORT:Transfer Rna RNA Protein biosynthesis Non-coding RNA Articles containing video clips