T7 RNA Polymerase is an
RNA polymerase
In molecular biology, RNA polymerase (abbreviated RNAP or RNApol), or more specifically DNA-directed/dependent RNA polymerase (DdRP), is an enzyme that synthesizes RNA from a DNA template.
Using the enzyme helicase, RNAP locally opens the ...
from the
T7 bacteriophage
A bacteriophage (), also known informally as a ''phage'' (), is a duplodnaviria virus that infects and replicates within bacteria and archaea. The term was derived from "bacteria" and the Greek φαγεῖν ('), meaning "to devour". Bact ...
that catalyzes the formation of
RNA
Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding, decoding, regulation and expression of genes. RNA and deoxyribonucleic acid ( DNA) are nucleic acids. Along with lipids, proteins, and carbohydra ...
from DNA in the 5'→ 3' direction.
Activity
T7 polymerase is extremely
promoter-specific and transcribes only DNA downstream of a T7 promoter.
[ The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa.
]
Promoter
The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is:[
5' * 3'
T7 TAATACGACTCACTATAGGGAGA
T3 AATTAACCCTCACTAAAGGGAGA
K11 AATTAGGGCACACTATAGGGAGA
SP6 ATTTACGACACACTATAGAAGAA
bind------------
-----------init
Transcription begins at the asterisk-marked guanine.][
]
Structure
T7 polymerase has been crystallised in several forms and the structures placed in the PDB PDB may refer to:
* Chess Problem Database Server (PDB Server)
* 1,4-Dichlorobenzene (paradichlorobenzene)
* Party of German-speaking Belgians, (German: '), a political party and predecessor of the ProDG
* PDB (Palm OS), a container format for reco ...
. These explain how T7 polymerase binds to DNA and transcribes it. The N-terminal domain moves around as the elongation complex forms. The ssRNAP holds a DNA-RNA hybrid of 8bp. A beta-hairpin
The beta hairpin (sometimes also called beta-ribbon or beta-beta unit) is a simple protein structural motif involving two beta strands that look like a hairpin. The motif consists of two strands that are adjacent in primary structure, oriented ...
specificity loop (residues 739-770 in T7) recognizes the promoter; swapping it out for one found in T3 RNAP makes the polymerase recognize T3 promoters instead.
Similar to other viral nucleic acid polymerases, including T7 DNA polymerase
T7 DNA polymerase is an enzyme used during the DNA replication of the T7 bacteriophage. During this process, the DNA polymerase “reads” existing DNA strands and creates two new strands that match the existing ones. The T7 DNA polymerase requir ...
from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand with three subdomains termed fingers, palm, and thumb. The N-terminal is less conserved. It forms a promoter-binding domain (PBD) with helix bundles in phage ssRNAPs, a feature not found in mitochondrial ssRNAPs.
Related proteins
T7 polymerase is a representative member of the single-subunit DNA-dependent RNAP (ssRNAP) family. Other members include phage T3 and SP6 RNA polymerases, the mitochondrial RNA polymerase (POLRMT
POLRMT is a symbol of RNA polymerase mitochondrial
It is a DNA-directed RNA polymerase, mitochondrial is an enzyme that in humans is encoded by the ''POLRMT'' gene.
Function
This gene encodes a mitochondrial DNA-directed RNA polymerase. The ge ...
), and the chloroplastic ssRNAP. The ssRNAP family is structurally and evolutionarily distinct from the multi-subunit family of RNA polymerases (including bacterial and eukaryotic sub-families). In contrast to bacterial RNA polymerases, T7 polymerase is not inhibited by the antibiotic rifampicin
Rifampicin, also known as rifampin, is an ansamycin antibiotic used to treat several types of bacterial infections, including tuberculosis (TB), ''Mycobacterium avium'' complex, leprosy, and Legionnaires’ disease. It is almost always used ...
. This family is related to single-subunit reverse transcriptase
A reverse transcriptase (RT) is an enzyme used to generate complementary DNA (cDNA) from an RNA template, a process termed reverse transcription. Reverse transcriptases are used by viruses such as HIV and hepatitis B to replicate their genomes, ...
and DNA polymerase
A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules from nucleoside triphosphates, the molecular precursors of DNA. These enzymes are essential for DNA replication and usually work in groups to create ...
.
Application
In biotechnology applications, T7 RNA polymerase is commonly used to transcribe DNA that has been cloned into vectors that have two (different) phage promoters (e.g., T7 and T3, or T7 and SP6) in opposite orientation. RNA can be selectively synthesized from either strand of the insert DNA with the different polymerases. The enzyme is stimulated by spermidine
Spermidine is a polyamine compound () found in ribosomes and living tissues and having various metabolic functions within organisms. It was originally isolated from semen.
Function
Spermidine is an aliphatic polyamine. Spermidine synthase (SPDS ...
and ''in vitro'' activity is increased by the presence of carrier proteins (such as BSA
BSA may refer to:
Businesses and organizations
* Basketball South Africa
* Bearing Specialists Association
* Belarusian Socialist Assembly
* Bibliographical Society of America
* Birmingham Small Arms Company, UK manufacturer of firearms and vehic ...
)
Homogeneously labeled single-stranded RNA can be generated with this system. Transcripts can be non-radioactively labeled to high specific activity with certain labeled nucleotides.
See also
* T7 expression system The T7 expression system is used in the field of microbiology to clone recombinant DNA using strains of E. coli. It is the most popular system for expressing recombinant proteins in E. coli.
By 2021, this system had been described in over 220,000 ...
References
Further reading
*
*
*
* - note that the nuclease activity reported here is an artifact.
External links
T7 RNA Polymerase Enzymology
OpenWetWare
{{polymerases
RNA
Phage proteins