|
POLRMT
DNA-directed RNA polymerase, mitochondrial is an enzyme that in humans is encoded by the ''POLRMT'' gene. Function This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of bacteriophage (including T7 RNA polymerase), mitochondrial polymerases of lower eukaryotes as well as chloroplastic RpoT polymerases. Structure The structure of the enzyme has been solved. It exhibits an overall structure similar to that of phage RNAP, but the initiation mechanism is different in that it requires initiation factors TFAM Mitochondrial transcription factor A, abbreviated as ''TFAM'' or ''mtTFA'', is a protein that in humans is encoded by the ''TFAM'' gene. Function This gen ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Mitochondrial DNA
Mitochondrial DNA (mtDNA and mDNA) is the DNA located in the mitochondrion, mitochondria organelles in a eukaryotic cell that converts chemical energy from food into adenosine triphosphate (ATP). Mitochondrial DNA is a small portion of the DNA contained in a eukaryotic cell; most of the DNA is in the cell nucleus, and, in plants and algae, the DNA also is found in plastids, such as chloroplasts. Mitochondrial DNA is responsible for coding of 13 essential subunits of the complex oxidative phosphorylation (OXPHOS) system which has a role in cellular energy conversion. Human mitochondrial DNA was the first significant part of the human genome to be sequenced. This sequencing revealed that human mtDNA has 16,569 base pairs and encodes 13 proteins. As in other vertebrates, the human mitochondrial genetic code differs slightly from nuclear DNA. Since animal mtDNA evolves faster than nuclear genetic markers, it represents a mainstay of phylogenetics and evolutionary biology. It als ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
RNA Polymerase
In molecular biology, RNA polymerase (abbreviated RNAP or RNApol), or more specifically DNA-directed/dependent RNA polymerase (DdRP), is an enzyme that catalyzes the chemical reactions that synthesize RNA from a DNA template. Using the enzyme helicase, RNAP locally opens the double-stranded DNA so that one strand of the exposed nucleotides can be used as a template for the synthesis of RNA, a process called transcription. A transcription factor and its associated transcription mediator complex must be attached to a DNA binding site called a promoter region before RNAP can initiate the DNA unwinding at that position. RNAP not only initiates RNA transcription, it also guides the nucleotides into position, facilitates attachment and elongation, has intrinsic proofreading and replacement capabilities, and termination recognition capability. In eukaryotes, RNAP can build chains as long as 2.4 million nucleotides. RNAP produces RNA that, functionally, is either for protei ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and trans ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
TFB2M
Dimethyladenosine transferase 2; transcription factor B2, mitochondrial is an enzyme that in humans is encoded by the ''TFB2M'' gene. This protein is a transcription initiation factor for the mitochondrial RNA polymerase, POLRMT. Its paralog TFB1M can perform a similar function, but only ''in vitro ''In vitro'' (meaning ''in glass'', or ''in the glass'') Research, studies are performed with Cell (biology), cells or biological molecules outside their normal biological context. Colloquially called "test-tube experiments", these studies in ...''. References Further reading * * * * * * * * * * * {{gene-1-stub ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Enzyme
An enzyme () is a protein that acts as a biological catalyst by accelerating chemical reactions. The molecules upon which enzymes may act are called substrate (chemistry), substrates, and the enzyme converts the substrates into different molecules known as product (chemistry), products. Almost all metabolism, metabolic processes in the cell (biology), cell need enzyme catalysis in order to occur at rates fast enough to sustain life. Metabolic pathways depend upon enzymes to catalyze individual steps. The study of enzymes is called ''enzymology'' and the field of pseudoenzyme, pseudoenzyme analysis recognizes that during evolution, some enzymes have lost the ability to carry out biological catalysis, which is often reflected in their amino acid sequences and unusual 'pseudocatalytic' properties. Enzymes are known to catalyze more than 5,000 biochemical reaction types. Other biocatalysts include Ribozyme, catalytic RNA molecules, also called ribozymes. They are sometimes descr ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Gene
In biology, the word gene has two meanings. The Mendelian gene is a basic unit of heredity. The molecular gene is a sequence of nucleotides in DNA that is transcribed to produce a functional RNA. There are two types of molecular genes: protein-coding genes and non-coding genes. During gene expression (the synthesis of Gene product, RNA or protein from a gene), DNA is first transcription (biology), copied into RNA. RNA can be non-coding RNA, directly functional or be the intermediate protein biosynthesis, template for the synthesis of a protein. The transmission of genes to an organism's offspring, is the basis of the inheritance of phenotypic traits from one generation to the next. These genes make up different DNA sequences, together called a genotype, that is specific to every given individual, within the gene pool of the population (biology), population of a given species. The genotype, along with environmental and developmental factors, ultimately determines the phenotype ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Primer (molecular Biology)
A primer is a short, single-stranded nucleic acid used by all living organisms in the initiation of DNA synthesis. A synthetic primer is a type of oligo, short for oligonucleotide. DNA polymerases (responsible for DNA replication) are only capable of adding nucleotides to the 3’-end of an existing nucleic acid, requiring a primer be bound to the template before DNA polymerase can begin a complementary strand. DNA polymerase adds nucleotides after binding to the RNA primer and synthesizes the whole strand. Later, the RNA strands must be removed accurately and replaced with DNA nucleotides. This forms a gap region known as a nick that is filled in using a ligase. The removal process of the RNA primer requires several enzymes, such as Fen1, Lig1, and others that work in coordination with DNA polymerase, to ensure the removal of the RNA nucleotides and the addition of DNA nucleotides. Living organisms use solely RNA primers, while laboratory techniques in biochemistry and mole ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Bacteriophage
A bacteriophage (), also known informally as a phage (), is a virus that infects and replicates within bacteria. The term is derived . Bacteriophages are composed of proteins that Capsid, encapsulate a DNA or RNA genome, and may have structures that are either simple or elaborate. Their genomes may encode as few as four genes (e.g. Bacteriophage MS2, MS2) and as many as hundreds of genes. Phages replicate within the bacterium following the injection of their genome into its cytoplasm. Bacteriophages are among the most common and diverse entities in the biosphere. Bacteriophages are ubiquitous viruses, found wherever bacteria exist. It is estimated there are more than 1031 bacteriophages on the planet, more than every other organism on Earth, including bacteria, combined. Viruses are the most abundant biological entity in the water column of the world's oceans, and the second largest component of biomass after prokaryotes, where up to 9x108 virus, virions per millilitre have b ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Eukaryote
The eukaryotes ( ) constitute the Domain (biology), domain of Eukaryota or Eukarya, organisms whose Cell (biology), cells have a membrane-bound cell nucleus, nucleus. All animals, plants, Fungus, fungi, seaweeds, and many unicellular organisms are eukaryotes. They constitute a major group of Outline of life forms, life forms alongside the two groups of prokaryotes: the Bacteria and the Archaea. Eukaryotes represent a small minority of the number of organisms, but given their generally much larger size, their collective global biomass is much larger than that of prokaryotes. The eukaryotes emerged within the archaeal Kingdom (biology), kingdom Asgard (Archaea), Promethearchaeati and its sole phylum Promethearchaeota. This implies that there are only Two-domain system, two domains of life, Bacteria and Archaea, with eukaryotes incorporated among the Archaea. Eukaryotes first emerged during the Paleoproterozoic, likely as Flagellated cell, flagellated cells. The leading evolutiona ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
TFAM
Mitochondrial transcription factor A, abbreviated as ''TFAM'' or ''mtTFA'', is a protein that in humans is encoded by the ''TFAM'' gene. Function This gene encodes a mitochondrial transcription factor that is a key activator of mitochondrial transcription as well as a participant in mitochondrial genome replication. TFAM binds mitochondrial promoter DNA to aid transcription of the mitochondrial genome. Studies in mice have demonstrated that this gene product is required to regulate the mitochondrial genome copy number and is essential for embryonic development. A mouse model for Kearns–Sayre syndrome Kearns–Sayre syndrome (KSS), oculocraniosomatic disorder or oculocranionsomatic neuromuscular disorder with ragged red fibers is a mitochondrial myopathy with a typical onset before 20 years of age. KSS is a more severe syndromic variant of chr ... was produced when expression of this gene was eliminated by targeted disruption in heart and muscle cells. TFAM is a double box ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
MTERF1
Mitochondrial transcription termination factor 1, also known as MTERF1, is a protein which in humans is encoded by the ''MTERF'' gene. This gene encodes a mitochondrial transcription termination factor. This protein participates in attenuating transcription from the mitochondrial genome; this attenuation allows higher levels of expression of 16S ribosomal RNA relative to the tRNA gene downstream. The product of this gene has three leucine zipper A leucine zipper (or leucine scissors) is a common three-dimensional structural motif in proteins. They were first described by Landschulz and collaborators in 1988 when they found that an enhancer binding protein had a very characteristic 30-amin ... motifs bracketed by two basic domains that are all required for DNA binding. There is evidence that, for this protein, the zippers participate in intramolecular interactions that establish the three-dimensional structure required for DNA binding. References Further reading * * * * * ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
