|
DNA Walker
A DNA walker is a class of nucleic acid nanomachines where a nucleic acid "walker" is able to move along a nucleic acid "track". The concept of a DNA walker was first defined and named by John H. Reif in 2003. A nonautonomous DNA walker requires external changes for each step, whereas an autonomous DNA walker progresses without any external changes. Various nonautonomous DNA walkers were developed, for example Shin controlled the motion of DNA walker by using 'control strands' which needed to be manually added in a specific order according to the template's sequence in order to get the desired path of motion. In 2004 the first autonomous DNA walker, which did not require external changes for each step, was experimentally demonstrated by the Reif group. DNA walkers have functional properties such as a range of motion extending from linear to 2 and 3-dimensional, the ability to pick up and drop off molecular cargo, performing DNA-templated synthesis, and increased velocity of moti ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Nucleic Acid
Nucleic acids are biopolymers, macromolecules, essential to all known forms of life. They are composed of nucleotides, which are the monomers made of three components: a 5-carbon sugar, a phosphate group and a nitrogenous base. The two main classes of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). If the sugar is ribose, the polymer is RNA; if the sugar is the ribose derivative deoxyribose, the polymer is DNA. Nucleic acids are naturally occurring chemical compounds that serve as the primary information-carrying molecules in cells and make up the genetic material. Nucleic acids are found in abundance in all living things, where they create, encode, and then store information of every living cell of every life-form on Earth. In turn, they function to transmit and express that information inside and outside the cell nucleus to the interior operations of the cell and ultimately to the next generation of each living organism. The encoded informatio ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Ribonuclease H
Ribonuclease H (abbreviated RNase H or RNH) is a family of non-sequence-specific endonuclease enzymes that catalyze the cleavage of RNA in an RNA/ DNA substrate via a hydrolytic mechanism. Members of the RNase H family can be found in nearly all organisms, from bacteria to archaea to eukaryotes. The family is divided into evolutionarily related groups with slightly different substrate preferences, broadly designated ribonuclease H1 and H2. The human genome encodes both H1 and H2. Human ribonuclease H2 is a heterotrimeric complex composed of three subunits, mutations in any of which are among the genetic causes of a rare disease known as Aicardi–Goutières syndrome. A third type, closely related to H2, is found only in a few prokaryotes, whereas H1 and H2 occur in all domains of life. Additionally, RNase H1-like retroviral ribonuclease H domains occur in multidomain reverse transcriptase proteins, which are encoded by retroviruses such as HIV and are required for viral repli ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Nanorobotics
Nanoid robotics, or for short, nanorobotics or nanobotics, is an emerging technology field creating machines or robots whose components are at or near the scale of a nanometer (10−9 meters). More specifically, nanorobotics (as opposed to microrobotics) refers to the nanotechnology engineering discipline of designing and building nanorobots with devices ranging in size from 0.1 to 10 micrometres and constructed of nanoscale or molecular components. The terms ''nanobot'', ''nanoid'', ''nanite'', ''nanomachine'' and ''nanomite'' have also been used to describe such devices currently under research and development. Nanomachines are largely in the research and development phase, but some primitive molecular machines and nanomotors have been tested. An example is a sensor having a switch approximately 1.5 nanometers across, able to count specific molecules in the chemical sample. The first useful applications of nanomachines may be in nanomedicine. For example, biological mac ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Water Pollution
Water pollution (or aquatic pollution) is the contamination of water bodies, usually as a result of human activities, so that it negatively affects its uses. Water bodies include lakes, rivers, oceans, aquifers, reservoirs and groundwater. Water pollution results when contaminants are introduced into these water bodies. Water pollution can be attributed to one of four sources: sewage discharges, industrial activities, agricultural activities, and urban runoff including stormwater. It can be grouped into surface water pollution (either fresh water pollution or marine pollution) or groundwater pollution. For example, releasing inadequately treated wastewater into natural waters can lead to degradation of these aquatic ecosystems. Water pollution can also lead to water-borne diseases for people using polluted water for drinking, bathing, washing or irrigation. Water pollution reduces the ability of the body of water to provide the ecosystem services (such as drinking water ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Heavy Metal (chemical Element)
upright=1.2, Crystals of lead.html" ;"title="osmium, a heavy metal nearly twice as dense as lead">osmium, a heavy metal nearly twice as dense as lead Heavy metals are generally defined as metals with relatively high density, densities, atomic weights, or atomic numbers. The criteria used, and whether metalloids are included, vary depending on the author and context. In metallurgy, for example, a heavy metal may be defined on the basis of density, whereas in physics the distinguishing criterion might be atomic number, while a chemist would likely be more concerned with chemical property, chemical behaviour. More specific definitions have been published, but none of these have been widely accepted. The definitions surveyed in this article encompass up to 96 out of the 118 known chemical elements; only mercury, lead and bismuth meet all of them. Despite this lack of agreement, the term (plural or singular) is widely used in science. A density of more than 5 g/cm3 is somet ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Mutation
In biology, a mutation is an alteration in the nucleic acid sequence of the genome of an organism, virus, or extrachromosomal DNA. Viral genomes contain either DNA or RNA. Mutations result from errors during DNA or viral replication, mitosis, or meiosis or other types of damage to DNA (such as pyrimidine dimers caused by exposure to ultraviolet radiation), which then may undergo error-prone repair (especially microhomology-mediated end joining), cause an error during other forms of repair, or cause an error during replication ( translesion synthesis). Mutations may also result from insertion or deletion of segments of DNA due to mobile genetic elements. Mutations may or may not produce detectable changes in the observable characteristics ( phenotype) of an organism. Mutations play a part in both normal and abnormal biological processes including: evolution, cancer, and the development of the immune system, including junctional diversity. Mutation is the ultima ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
DNA Nanotube
DNA nanotechnology is the design and manufacture of artificial nucleic acid structures for technological uses. In this field, nucleic acids are used as non-biological engineering materials for nanotechnology rather than as the carriers of genetic information in living Cell (biology), cells. Researchers in the field have created static structures such as two- and three-dimensional Crystal structure, crystal lattices, nanotubes, Polyhedron, polyhedra, and arbitrary shapes, and functional devices such as molecular machines and DNA computing, DNA computers. The field is beginning to be used as a tool to solve basic science problems in structural biology and biophysics, including applications in X-ray crystallography and nuclear magnetic resonance spectroscopy of proteins to determine structures. Potential applications in molecular scale electronics and nanomedicine are also being investigated. The conceptual foundation for DNA nanotechnology was first laid out by Nadrian Seeman in th ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Nucleoside Triphosphate
A nucleoside triphosphate is a nucleoside containing a nitrogenous base bound to a 5-carbon sugar (either ribose or deoxyribose), with three phosphate groups bound to the sugar. They are the molecular precursors of both DNA and RNA, which are chains of nucleotides made through the processes of DNA replication and transcription. Nucleoside triphosphates also serve as a source of energy for cellular reactions and are involved in signalling pathways. Nucleoside triphosphates cannot be absorbed well, so they are typically synthesized within the cell. Synthesis pathways differ depending on the specific nucleoside triphosphate being made, but given the many important roles of nucleoside triphosphates, synthesis is tightly regulated in all cases. Nucleoside analogues may also be used to treat viral infections. For example, azidothymidine (AZT) is a nucleoside analogue used to prevent and treat HIV/AIDS. Naming The term nucleoside refers to a nitrogenous base linked to a 5-car ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Stator
The stator is the stationary part of a rotary system, found in electric generators, electric motors, sirens, mud motors or biological rotors. Energy flows through a stator to or from the rotating component of the system. In an electric motor, the stator provides a magnetic field that drives the rotating armature; in a generator, the stator converts the rotating magnetic field to electric current. In fluid powered devices, the stator guides the flow of fluid to or from the rotating part of the system. Design Motor stators are made either from iron/steel or from a printed circuit board (PCB). Originally applied to low-power applications, PCB stators can be lighter, smaller, and less noisy. One design embeds thin copper traces in the PCB stator that serve as the windings. The traces are interleaved with epoxy-glass laminates, that insulate each coil from its neighbors. An air core replaces the traditional iron core, saving space and weight, and allowing a smaller air gap ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and tra ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Catenation
In chemistry, catenation is the bonding of atoms of the same element into a series, called a ''chain''. A chain or a ring shape may be ''open'' if its ends are not bonded to each other (an open-chain compound), or ''closed'' if they are bonded in a ring (a cyclic compound). The words ''to catenate'' and ''catenation'' reflect the Latin root '' catena'', "chain". Carbon Catenation occurs most readily with carbon, which forms covalent bonds with other carbon atoms to form longer chains and structures. This is the reason for the presence of the vast number of organic compounds in nature. Carbon is most well known for its properties of catenation, with organic chemistry essentially being the study of catenated carbon structures (and known as catenae). Carbon chains in biochemistry combine any of various other elements, such as hydrogen, oxygen, and biometals, onto the backbone of carbon. However, carbon is by no means the only element capable of forming such catenae, and sever ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
