The ''lacUV5'' promoter is a mutated promoter from the ''

Escherichia coli ''Escherichia coli'' ( )Wells, J. C. (2000) Longman Pronunciation Dictionary. Harlow ngland Pearson Education Ltd. is a gram-negative, facultative anaerobic, rod-shaped, coliform bacterium of the genus '' Escherichia'' that is commonly fo ...

'' lac operon which is used in

molecular biology Molecular biology is a branch of biology that seeks to understand the molecule, molecular basis of biological activity in and between Cell (biology), cells, including biomolecule, biomolecular synthesis, modification, mechanisms, and interactio ...

to drive

gene expression Gene expression is the process (including its Regulation of gene expression, regulation) by which information from a gene is used in the synthesis of a functional gene product that enables it to produce end products, proteins or non-coding RNA, ...

on a

plasmid A plasmid is a small, extrachromosomal DNA molecule within a cell that is physically separated from chromosomal DNA and can replicate independently. They are most commonly found as small circular, double-stranded DNA molecules in bacteria and ...

. ''lacUV5'' is very similar to the classical ''lac'' promoter, containing just 2 base pair mutations in the -10 hexamer region, compared to the ''lac'' promoter. ''LacUV5'' is among the most commonly used promoters in molecular biology because it requires no additional activators and it drives high levels of gene expression. The ''lacUV5'' promoter sequence conforms more closely to the

consensus sequence In molecular biology and bioinformatics, the consensus sequence (or canonical sequence) is the calculated sequence of most frequent residues, either nucleotide or amino acid, found at each position in a sequence alignment. It represents the result ...

recognized by bacterial

sigma factor A sigma factor (σ factor or specificity factor) is a protein needed for initiation of Transcription (biology), transcription in bacteria. It is a bacterial transcription initiation factor that enables specific binding of RNA polymerase (RNAP) to g ...

s than the traditional ''lac'' promoter does. Due to this, ''lacUV5'' recruits

RNA Polymerase In molecular biology, RNA polymerase (abbreviated RNAP or RNApol), or more specifically DNA-directed/dependent RNA polymerase (DdRP), is an enzyme that catalyzes the chemical reactions that synthesize RNA from a DNA template. Using the e ...

more effectively, thus leading to higher transcription of target genes. Additionally, unlike the ''lac'' promoter, ''lacUV5'' works independently of activator proteins or other cis regulatory elements (apart from the -10 and -35 promoter regions). While no activators are required, ''lacUV5'' promoter expression can be regulated by the LacI repressor and can be induced with IPTG, which is an effective inducer of protein expression when used in the concentration range of 100 μM to 1.5 mM. Due to this control, the ''lacUV5'' promoter is commonly found on expression plasmids and is used when controllable but high levels of a product are desired. The ''lacUV5'' mutation was first identified in 1970 in a study of ''lac'' promoter mutants that produce higher yields. Some of them, including UV5, has lost catabolite repression at the CAP site. Development into cloning vectors is known since 1982, when a UV5-carrying phage known as "λ h80 ''lac''UV5 cI857" has its genome spliced with the

HaeIII HaeIII is one of many restriction enzymes ( endonucleases) a type of prokaryotic DNA that protects organisms from unknown, foreign DNA. It is a restriction enzyme used in molecular biology laboratories. It was the third endonuclease to be isolat ...

restriction enzyme A restriction enzyme, restriction endonuclease, REase, ENase or'' restrictase '' is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class o ...

to make plasmids carrying the fragment with UV5.

Sequence

Modern ''lacUV5'' is seen in the BL21(DE3) strain, which carries both a ''lac'' operon with the standard promoter and a ''lacUV5'' operon split by the DE3 prophage (and as a result driving the

T7 RNA polymerase T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promo ...

instead). The two important mutations are underlined. ''lacUV5'' TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT LacZ TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGAAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT position ^-35 ^-10 ^+1

References

Escherichia coli Gene expression Genetics techniques {{Genetics-stub