Haplogroup I-M253, also known as I1, is a

Y chromosome The Y chromosome is one of two sex chromosomes in therian mammals and other organisms. Along with the X chromosome, it is part of the XY sex-determination system, in which the Y is the sex-determining chromosome because the presence of the ...

haplogroup A haplotype is a group of alleles in an organism that are inherited together from a single parent, and a haplogroup (haploid from the , ''haploûs'', "onefold, simple" and ) is a group of similar haplotypes that share a common ancestor with a sing ...

. The genetic markers confirmed as identifying I-M253 are the

SNPs In genetics and bioinformatics, a single-nucleotide polymorphism (SNP ; plural SNPs ) is a germline substitution of a single nucleotide at a specific position in the genome. Although certain definitions require the substitution to be present in ...

M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187. It is a primary branch of

Haplogroup I-M170 Haplogroup I (M170) is a Human Y-chromosome DNA haplogroup, Y-chromosome DNA haplogroup. It is a subgroup of haplogroup IJ (Y-DNA), haplogroup IJ, which itself is a derivative of the Haplogroup IJK (Y-DNA), haplogroup IJK. Subclades Haplogroup ...

(I*). Haplogroup I1 is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-

Neolithic The Neolithic or New Stone Age (from Ancient Greek, Greek 'new' and 'stone') is an archaeological period, the final division of the Stone Age in Mesopotamia, Asia, Europe and Africa (c. 10,000 BCE to c. 2,000 BCE). It saw the Neolithic Revo ...

DNA samples it cannot have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a

founder effect In population genetics, the founder effect is the loss of genetic variation that occurs when a new population is established by a very small number of individuals from a larger population. It was first fully outlined by Ernst Mayr in 1942, us ...

in the

Nordic Bronze Age The Nordic Bronze Age (also Northern Bronze Age, or Scandinavian Bronze Age) is a period of Scandinavian prehistory from . The Nordic Bronze Age culture emerged about 1750 BC as a continuation of the Late Neolithic Dagger period, which is root ...

. Today it reaches its peak frequencies in

Sweden Sweden, formally the Kingdom of Sweden, is a Nordic countries, Nordic country located on the Scandinavian Peninsula in Northern Europe. It borders Norway to the west and north, and Finland to the east. At , Sweden is the largest Nordic count ...

(52 percent of males in

Västra Götaland County Västra Götaland County () is a county or '' län'' on the western coast of Sweden. The county is the second most populous of Sweden's counties and it comprises 49 municipalities (''kommuner''). Its population of 1,616,000 amounts to 17% of S ...

) and western

Finland Finland, officially the Republic of Finland, is a Nordic country in Northern Europe. It borders Sweden to the northwest, Norway to the north, and Russia to the east, with the Gulf of Bothnia to the west and the Gulf of Finland to the south, ...

(more than 50 percent in

Satakunta Satakunta (in both Finnish language, Finnish and Swedish language, Swedish, ; historically ''Satacundia'') is a Regions of Finland, region ( / ) of Finland, part of the former Western Finland Province. It borders the regions of Southwest Finland ...

province). In terms of national averages, I-M253 is found in 38-39% of Swedish males, 37% of Norwegian males, 34.8% of Danish males, 34.5% of Icelandic males, and about 28% of Finnish males. Bryan Sykes, in his 2006 book ''Blood of the Isles'', gives the members – and the notional founding patriarch of I1 the name "

Wodan Odin (; from ) is a widely revered god in Norse mythology and Germanic paganism. Most surviving information on Odin comes from Norse mythology, but he figures prominently in the recorded history of Northern Europe. This includes the Roman Emp ...

". All known living members descend from a common ancestor 6 times younger than the common ancestor with I2. Before a reclassification in 2008, the group was known as ''I1a'', a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925). More than 99% of living men with I1 belong to the DF29 branch which is estimated to have emerged in 2400 BCE. All DF29 men share a common ancestor born between 2500 and 2400 BCE. The oldest ancient individual with I1-DF29 found is Oll009, a man from early Bronze Age Sweden. A 2024 study found that I1-M253 expanded rapidly during a migration from the eastern or northeastern parts of Scandinavia into Southern Sweden, Denmark and Norway around 2000 BC and was associated with the introduction of stone cist burials. The study concluded that the spread of Y-DNA haplogroup I1 was associated with a genetic cluster labelled as "LNBA phase III" and that this genetic cluster formed the predominant ancestry source for Bronze Age, Iron Age and Viking Age Scandinavians, as well as other ancient European groups with a documented Scandinavian or Germanic association (for example, Anglo-Saxons and Goths; Extended Data Fig. 6e).

Origins

While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the

Gravettian The Gravettian is an archaeological industry of the European Upper Paleolithic that succeeded the Aurignacian circa 33,000 years BP. It is archaeologically the last European culture many consider unified, and had mostly disappeared by ...

, so far DNA studies have only been able to locate it in three

Paleolithic The Paleolithic or Palaeolithic ( years ago) ( ), also called the Old Stone Age (), is a period in human prehistory that is distinguished by the original development of stone tools, and which represents almost the entire period of human prehist ...

and

Mesolithic The Mesolithic (Ancient Greek language, Greek: μέσος, ''mesos'' 'middle' + λίθος, ''lithos'' 'stone') or Middle Stone Age is the Old World archaeological period between the Upper Paleolithic and the Neolithic. The term Epipaleolithic i ...

hunter-gatherers. As of November 2022, only 6 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1: * BAL051. A hunter-gatherer from the Azilian in Spain in 11,466 BCE classified as having a now extinct branch of I-Z2699. * Burial SF11 Date: 7500 BC– A Scandinavian hunter-gatherer with the label SF11 found on Stora Karlsö on

Gotland Gotland (; ; ''Gutland'' in Gutnish), also historically spelled Gottland or Gothland (), is Sweden's largest island. It is also a Provinces of Sweden, province/Counties of Sweden, county (Swedish län), Municipalities of Sweden, municipality, a ...

. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*. SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö. * Burial BAB5: Assumed a date of 5600-4900 BC according to archaeological context, although without C14 dating – An individual sample from Balatonszemes-Bagodomb labelled BAB5, from

Hungary Hungary is a landlocked country in Central Europe. Spanning much of the Pannonian Basin, Carpathian Basin, it is bordered by Slovakia to the north, Ukraine to the northeast, Romania to the east and southeast, Serbia to the south, Croatia and ...

. BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*. The skeletal remains of BAB5 have not been radiocarbon dated, and the 2015 study provides no analysis of the sample's autosomal ancestry. A 2023 study with samples from the same site features several Migration Period Langobard aDNA samples, putting doubts to the archaeological dating of sample BAB5. * Burial RISE179 Date: 2010-1776 BC – An individual found in a

kurgan A kurgan is a type of tumulus (burial mound) constructed over a grave, often characterized by containing a single human body along with grave vessels, weapons, and horses. Originally in use on the Pontic–Caspian steppe, kurgans spread into mu ...

burial dating to the late Neolithic Dagger Period in

Scandinavia Scandinavia is a subregion#Europe, subregion of northern Europe, with strong historical, cultural, and linguistic ties between its constituent peoples. ''Scandinavia'' most commonly refers to Denmark, Norway, and Sweden. It can sometimes also ...

labelled RISE179. The grave is located close to Abbekås on the south coast of Skåne RISE179 had a genetic affinity to the populations of the

Corded Ware culture The Corded Ware culture comprises a broad archaeological horizon of Europe between – 2350 BC, thus from the Late Neolithic, through the Copper Age, and ending in the early Bronze Age. Corded Ware culture encompassed a vast area, from t ...

and the Unetice culture. * Burial oll009 Date:1930-1750 BC - A LNBA individual from Southern Sweden. oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Oll009 is dated to the Scandinavian late Neolithic and was found in a burial in Sweden close to Öllsjö on the east coast of Skåne. Similar to RISE179, he carried a high percentage of Western Steppe-Herder ancestry and had a genetic affinity to the population of the

Battle Axe culture The Battle Axe culture, also called Boat Axe culture, is a Chalcolithic culture that flourished in the coastal areas of the south of the Scandinavian Peninsula and southwest Finland, from . It was an offshoot of the Corded Ware culture, and repl ...

and other populations of the Corded Ware horizon. oll009 has Y11204 but does not seem to have Y164553 or Y11205. Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia. Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age. Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the

, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the

Funnelbeaker culture The Funnel(-neck-)beaker culture, in short TRB or TBK (, ; ; ), was an archaeological culture in north-central Europe. It developed as a technological merger of local neolithic and mesolithic techno-complexes between the lower Elbe and middle V ...

in Central Europe; or the steppe itself. Future research will most likely be able to determine which one of these two possible origins turns out to be the case. Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2600 BC. According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in

Chalcolithic Europe The Chalcolithic (also Eneolithic, Copper Age) period of Prehistoric Europe lasted roughly from 5000 to 2000 BC, developing from the preceding Neolithic period and followed by the Bronze Age. It was a period of Megalithic culture, the appeara ...

. A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques. In 2007, it was suggested that it initially dispersed from the area that is now

Denmark Denmark is a Nordic countries, Nordic country in Northern Europe. It is the metropole and most populous constituent of the Kingdom of Denmark,, . also known as the Danish Realm, a constitutionally unitary state that includes the Autonomous a ...

.Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in ''Rethinking the Human Revolution'' (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK. However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower

Elbe The Elbe ( ; ; or ''Elv''; Upper Sorbian, Upper and , ) is one of the major rivers of Central Europe. It rises in the Giant Mountains of the northern Czech Republic before traversing much of Bohemia (western half of the Czech Republic), then Ge ...

basin seems like the heartland of I1". Latest results (January 2022) published b
Y-Full
suggest I1 (I-M253) was formed 27,500 ybp ( 95 CI: 29,800 ybp – 25,200 ybp) with TMRCA 4,600 ybp (95 CI: 5,200 ybp – 4,000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2600 BC, this likely puts the ancestor of all living I1 men somewhere in Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion. This suggests that I1 went from being a rare marker to a rather common one in a rapid burst.

Structure

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 ISOGG, ''Y-DNA Haplogroup I and its Subclades – 2017''
(31 January 2017). * ''I-DF29'' (DF29/S438); ''I1a'' ** ''I-CTS6364'' (CTS6364/Z2336); ''I1a1'' *** FGC20030; I1a1a~ **** S4767; I1a1a1~ ******* I-M227; I1a1a1a1a **** A394; I1a1a2~ **** Y11221; I1a1a3~ **** A5338; I1a1a4~ *** CTS10028; I1a1b **** I-L22 (L22/S142); I1a1b1 ***** CTS11651/Z2338; I1a1b1a~ ****** I-P109; I1a1b1a1 ******* I-Y3662; I1a1b1a1e~ ******** I-S14887; I1a1b1a1e2~ ********* I-Y11203; I1a1b1a1e2d~ ********** I-Y29630; I1a1b1a1e2d2~ ****** CTS6017; I1a1b1a2 ****** I-L205 (L205.1/L939.1/S239.1); I1a1b1a3 ****** CTS6868; I1a1b1a4 ******* I-Z74; I1a1b1a4a ******** CTS2208; I1a1b1a4a1~ ********* I-L287; I1a1b1a4a1a ********** I-L258 (L258/S335); I1a1b1a4a1a1 ******** I-L813; I1a1b1a4a2 ******** FGC12562; I1a1b1a4a3~ ***** CTS11603/S4744; I1a1b1b~ ****** I-FT40464 ******* I-Y19934 ******** I-L300 (L300/S241); I1a1b1b1a1 ********* I-Y31032 ********** I-Y32014 ********* I-Y22918 ********** I-Y21972 ********* I-Y24013 ********** I-Y24015 ******** I-Y19933 ********* I-Y19932 ********** I-Y22015 *********** I-FT57000 **** FGC10477/Y13056; I1a1b2 **** A8178, A8182, A8200, A8204; I1a1b3~ **** F13534.2/Y17263.2; I1a1b4~ ** ''I-Z58'' (S244/Z58); ''I1a2'' *** I-Z59 (S246/Z59); I1a2a **** I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1 ***** I-Z140 (Z140, Z141) ****** I-L338 ****** I-F2642 (F2642) ***** I-Z73 ****** I-L1302 ***** I-L573 ***** I-L803 **** I-Z382; I1a2a2 *** I-Z138 (S296/Z138, Z139); I1a2b **** I-Z2541 ** ''I-Z63'' (S243/Z63); ''I1a3'' *** I-BY151; I1a3a **** I-L849.2; I1a3a1 **** I-BY351; I1a3a2 ****** I-CTS10345 ******* I-Y10994 ****** I-Y7075 **** I-S2078 ***** I-S2077 ****** I-Y2245 (Y2245/PR683) ******* I-L1237 ******** I-FGC9550 ******* I-S10360 ******** I-S15301 ******* I-Y7234 **** I-BY62 (BY62); I1a3a3 * ''I-Z131'' (Z131/S249); ''I1b'' ** ''I-CTS6397''; ''I1b1'' * ''I-Z17943'' (Y18119/Z17925, S2304/Z17937); ''I1c''

Historical expansion

Haplogroup I1, as well as subclades of R1b such as R1b-Z18 and subclades of R1a such as R1a-Z284, are strongly associated with

Germanic peoples The Germanic peoples were tribal groups who lived in Northern Europe in Classical antiquity and the Early Middle Ages. In modern scholarship, they typically include not only the Roman-era ''Germani'' who lived in both ''Germania'' and parts of ...

and are linked to the

proto-Germanic Proto-Germanic (abbreviated PGmc; also called Common Germanic) is the linguistic reconstruction, reconstructed proto-language of the Germanic languages, Germanic branch of the Indo-European languages. Proto-Germanic eventually developed from ...

speakers of the

. Current DNA research indicates that I1 was close to non-existent in most of Europe outside of

and

northern Germany Northern Germany (, ) is a linguistic, geographic, socio-cultural and historic region in the northern part of Germany which includes the coastal states of Schleswig-Holstein, Mecklenburg-Vorpommern and Lower Saxony and the two city-states Hambur ...

before the

Migration Period The Migration Period ( 300 to 600 AD), also known as the Barbarian Invasions, was a period in European history marked by large-scale migrations that saw the fall of the Western Roman Empire and subsequent settlement of its former territories ...

. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanic peoples migrated across the Baltic Sea and settled alongside the

Vistula The Vistula (; ) is the longest river in Poland and the ninth-longest in Europe, at in length. Its drainage basin, extending into three other countries apart from Poland, covers , of which is in Poland. The Vistula rises at Barania Góra i ...

. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the

Goths The Goths were a Germanic people who played a major role in the fall of the Western Roman Empire and the emergence of medieval Europe. They were first reported by Graeco-Roman authors in the 3rd century AD, living north of the Danube in what is ...

. I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. The Kowalewko archeological site has been associated with the Wielbark culture. Therefore, the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy. The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations. In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300–400 AD from

Saxony-Anhalt Saxony-Anhalt ( ; ) is a States of Germany, state of Germany, bordering the states of Brandenburg, Saxony, Thuringia and Lower Saxony. It covers an area of and has a population of 2.17 million inhabitants, making it the List of German states ...

in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe. Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234. Material findings associated with the Lombards have been excavated in Crypta Balbi. The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the

Visigoths The Visigoths (; ) were a Germanic people united under the rule of a king and living within the Roman Empire during late antiquity. The Visigoths first appeared in the Balkans, as a Roman-allied Barbarian kingdoms, barbarian military group unite ...

. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1. This finding is in accordance with the common ancestral origin of the Visigoths and the

Ostrogoths The Ostrogoths () were a Roman-era Germanic peoples, Germanic people. In the 5th century, they followed the Visigoths in creating one of the two great Goths, Gothic kingdoms within the Western Roman Empire, drawing upon the large Gothic populatio ...

. The

Anglo-Saxon The Anglo-Saxons, in some contexts simply called Saxons or the English, were a Cultural identity, cultural group who spoke Old English and inhabited much of what is now England and south-eastern Scotland in the Early Middle Ages. They traced t ...

settlement of Britain introduced I1 to the British Isles. A 2022 study found that out of 120 samples from Anglo-Saxon period England, 41 samples or roughly 34.17% of the samples belonged to haplogroup I1. The study noted that there was a heavy correlation between "CNE" Continental North European-like ancestry and Y-DNA I1. During the

Viking Age The Viking Age (about ) was the period during the Middle Ages when Norsemen known as Vikings undertook large-scale raiding, colonising, conquest, and trading throughout Europe and reached North America. The Viking Age applies not only to their ...

, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.

Geographical distribution

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the

, the

, or modern times. It is found in all places invaded by the Norse. During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the

United States The United States of America (USA), also known as the United States (U.S.) or America, is a country primarily located in North America. It is a federal republic of 50 U.S. state, states and a federal capital district, Washington, D.C. The 48 ...

Australia Australia, officially the Commonwealth of Australia, is a country comprising mainland Australia, the mainland of the Australia (continent), Australian continent, the island of Tasmania and list of islands of Australia, numerous smaller isl ...

New Zealand New Zealand () is an island country in the southwestern Pacific Ocean. It consists of two main landmasses—the North Island () and the South Island ()—and List of islands of New Zealand, over 600 smaller islands. It is the List of isla ...

and

Canada Canada is a country in North America. Its Provinces and territories of Canada, ten provinces and three territories extend from the Atlantic Ocean to the Pacific Ocean and northward into the Arctic Ocean, making it the world's List of coun ...

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from

and

during the

. The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the

North Sea The North Sea lies between Great Britain, Denmark, Norway, Germany, the Netherlands, Belgium, and France. A sea on the European continental shelf, it connects to the Atlantic Ocean through the English Channel in the south and the Norwegian Se ...

with Anglo-Saxon migrations and Danish

Vikings Vikings were seafaring people originally from Scandinavia (present-day Denmark, Norway, and Sweden), who from the late 8th to the late 11th centuries raided, pirated, traded, and settled throughout parts of Europe.Roesdahl, pp. 9� ...

. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number ... This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea ... These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues. This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Prominent members of I-M253

Through direct testing or testing of their descendants and genealogical evidence, the following notable people have been shown to be I-M253: *

Alexander Hamilton Alexander Hamilton (January 11, 1755 or 1757July 12, 1804) was an American military officer, statesman, and Founding Fathers of the United States, Founding Father who served as the first U.S. secretary of the treasury from 1789 to 1795 dur ...

, founding father of the

. * The

Varangian The Varangians ( ; ; ; , or )Varangian
," Online Etymology Dictionary were

Šimon, said to be the founder of the Russian Vorontsov noble family (including Prince Mikhail Semyonovich Vorontsov and Illarion Ivanovich Vorontsov-Dashkov) belonged to haplogroup I1-Y15024. * The Rurikid Prince Sviatopolk the Accursed (son of

Vladimir the Great Vladimir I Sviatoslavich or Volodymyr I Sviatoslavych (; Christian name: ''Basil''; 15 July 1015), given the epithet "the Great", was Prince of Novgorod from 970 and Grand Prince of Kiev from 978 until his death in 1015. The Eastern Orthodox ...

) belonged to I1-S2077. *

Birger Jarl Birger Jarl or Birger Magnusson (21 October 1266) was a Swedish statesman and regent, ''Swedish jarls, jarl'', and a member of the House of Bjälbo, who played a pivotal role in consolidating Sweden after the civil wars between the House of Eri ...

, Duke of Sweden of the East Geatish House of Bjälbo, founder of

Stockholm Stockholm (; ) is the Capital city, capital and List of urban areas in Sweden by population, most populous city of Sweden, as well as the List of urban areas in the Nordic countries, largest urban area in the Nordic countries. Approximately ...

; his remains were exhumed and tested in 2002 and found to be I-M253. The House of Bjälbo also provided three kings of

Norway Norway, officially the Kingdom of Norway, is a Nordic countries, Nordic country located on the Scandinavian Peninsula in Northern Europe. The remote Arctic island of Jan Mayen and the archipelago of Svalbard also form part of the Kingdom of ...

, and one king of

in the 14th century. * British musician Gordon Sumner, known as Sting * William Bradford, Governor of the

Plymouth Colony Plymouth Colony (sometimes spelled Plimouth) was the first permanent English colony in New England from 1620 and the third permanent English colony in America, after Newfoundland and the Jamestown Colony. It was settled by the passengers on t ...

* William Brewster, an early colonist who emigrated to America on the

Mayflower ''Mayflower'' was an English sailing ship that transported a group of English families, known today as the Pilgrims, from England to the New World in 1620. After 10 weeks at sea, ''Mayflower'', with 102 passengers and a crew of about 30, reac ...

* Confederate general

Robert E. Lee Robert Edward Lee (January 19, 1807 – October 12, 1870) was a general officers in the Confederate States Army, Confederate general during the American Civil War, who was appointed the General in Chief of the Armies of the Confederate ...

. Other prominent members of the Lee family of Virginia and Maryland were Richard Lee I and

Richard Henry Lee Richard Henry Lee (January 20, 1732June 19, 1794) was an American statesman and Founding Father from Virginia, best known for the June 1776 Lee Resolution, the motion in the Second Continental Congress calling for the colonies' independence fr ...

. * The

House of Grimaldi The House of Grimaldi is the Dynasty, reigning house of the Monaco, Principality of Monaco. The house was founded in 1160 by Grimaldo Canella in Genoa and became the ruling house of Monaco when François Grimaldi, Francesco Grimaldi captured Mo ...

belong to a Scandinavian subclade of I1, downstream of I1-Y3549. * President of the United States

Andrew Jackson Andrew Jackson (March 15, 1767 – June 8, 1845) was the seventh president of the United States from 1829 to 1837. Before Presidency of Andrew Jackson, his presidency, he rose to fame as a general in the U.S. Army and served in both houses ...

. * Russian writer

Leo Tolstoy Count Lev Nikolayevich Tolstoy Tolstoy pronounced his first name as , which corresponds to the romanization ''Lyov''. () (; ,Throughout Tolstoy's whole life, his name was written as using Reforms of Russian orthography#The post-revolution re ...

. * Icelandic historian and poet

Snorri Sturluson Snorri Sturluson ( ; ; 1179 – 22 September 1241) was an Icelandic historian, poet, and politician. He was elected twice as lawspeaker of the Icelandic parliament, the Althing. He is commonly thought to have authored or compiled portions of th ...

* Swedish scientist and theologian

Emanuel Swedenborg Emanuel Swedenborg (; ; born Emanuel Swedberg; (29 January 168829 March 1772) was a Swedish polymath; scientist, engineer, astronomer, anatomist, Christian theologian, philosopher, and mysticism, mystic. He became best known for his book on the ...

Siener van Rensburg Nicolaas Pieter Johannes ("Niklaas" or "Siener") Janse van Rensburg (3 August 1864 – 11 March 1926) was a Boer from the South African Republic – also known as the Transvaal Republic – and later a citizen of Union of South Africa, Sout ...

Boer Boers ( ; ; ) are the descendants of the proto Afrikaans-speaking Free Burghers of the eastern Cape frontier in Southern Africa during the 17th, 18th, and 19th centuries. From 1652 to 1795, the Dutch East India Company controlled the Dutch ...

patriotic figure and mystic. * Björn Wahlroos, Finnish businessman and millionaire. * Finnish mathematician Rolf Nevanlinna. * American inventor

Samuel Morse Samuel Finley Breese Morse (April 27, 1791 – April 2, 1872) was an American inventor and painter. After establishing his reputation as a portrait painter, Morse, in his middle age, contributed to the invention of a Electrical telegraph#Morse ...

. * Swedish Footballers Sebastian Larsson and his father

Svante Svante is the shortening for the Swedish male first name Svantepolk. It originates from Slavic ancestors of first prominent Svantes in Sweden. The Slavic languages have the name which is rendered as Sviatopolk in Ukrainian, Russian and Bulgaria ...

Larsson belong to I1-Y24470. * Swedish YouTuber Felix Kjellberg (PewDiePie) belongs to I1-L22. * Swedish actor

Björn Andrésen Björn Johan Andrésen (born 26 January 1955) is a Swedish actor and musician. He is best known for playing the 14-year-old Tadzio in Luchino Visconti's 1971 film adaptation of the 1912 Thomas Mann novella '' Death in Venice''. He also played a ...

belongs to haplogroup I1-L22. His ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border. * American actor Chris Pine belongs to haplogroup I1-A13819. * Swedish Sámi Ice hockey player

Börje Salming Anders Börje Salming ( ; 17 April 1951 – 24 November 2022) was a Swedish ice hockey player. He was a defenceman who played professionally for 23 seasons, for the clubs Brynäs IF, Toronto Maple Leafs, Detroit Red Wings, and AIK Hockey, AIK. H ...

. * American colonist Edmund Rice. * German composer

Ludwig van Beethoven Ludwig van Beethoven (baptised 17 December 177026 March 1827) was a German composer and pianist. He is one of the most revered figures in the history of Western music; his works rank among the most performed of the classical music repertoire ...

Markers

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations. Name: M253 :Type: SNP :Source: M (Peter Underhill o
Stanford University
:Position
ChrY:13532101..13532101 (+ strand)
:Position (base pair): 283 :Total size (base pairs): 400 :Length: 1 :ISOGG HG: I1 :Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG :Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT :YCC HG: I1 :Nucleotide alleles change (mutation): C to T Name: M307 :Type: SNP :Source: M (Peter Underhill) :Position
ChrY:21160339..21160339 (+ strand)
:Length: 1 :ISOGG HG: I1 :Primer F: TTATTGGCATTTCAGGAAGTG :Primer R: GGGTGAGGCAGGAAAATAGC :YCC HG: I1 :Nucleotide alleles change (mutation): G to A Name: P30 :Type: SNP :Source: PS
Michael Hammer
of th
University of Arizona
an

at the University of Edinburgh) :Position
ChrY:13006761..13006761 (+ strand)
:Length: 1 :ISOGG HG: I1 :Primer F: GGTGGGCTGTTTGAAAAAGA :Primer R: AGCCAAATACCAGTCGTCAC :YCC HG: I1 :Nucleotide alleles change (mutation): G to A :Region: ARSDP Name: P40P40
/ref> :Type: SNP :Source: PS (Michael Hammer and James F. Wilson) :Position
ChrY:12994402..12994402 (+ strand)
:Length: 1 :ISOGG HG: I1 :Primer F: GGAGAAAAGGTGAGAAACC :Primer R: GGACAAGGGGCAGATT :YCC HG: I1 :Nucleotide alleles change (mutation): C to T :Region: ARSDP

References

External links

;Haplogroup I databases
Haplogroup I1 Project at FTDNA

Danish Demes Regional DNA Project at FTDNA

Haplogroup I-P109 Project

British Isles DNA Project
;General Y-DNA databases There are several public access databases featuring I-M253, including:

YHRD : Y-Chromosome STR Haplotype Reference Database

I1 YTree
{{DEFAULTSORT:Haplogroup I-M253 (Y-Dna) Human Y-DNA haplogroups, I-M253 Nordic Stone Age Stone Age Europe