T7 Phage
Bacteriophage T7 (or the T7 phage) is a bacteriophage, a virus that infects bacteria. It infects most strains of ''Escherichia coli'' and relies on these hosts to propagate. Bacteriophage T7 has a Lytic cycle, lytic life cycle, meaning that it destroys the cell it infects. It also possesses several properties that make it an ideal phage for experimentation: its purification and concentration have produced consistent values in chemical analyses; it can be rendered noninfectious by exposure to UV light; and it can be used in phage display to clone RNA-binding protein, RNA binding proteins. Discovery In a 1945 study by Demerec and Fano, T7 was used to describe one of the seven phage types (T1 to T7) that grow lytically on ''Escherichia coli''. Although all seven phages were numbered arbitrarily, phages with odd numbers, or T-odd phages, were later discovered to share morphological and biochemical features that distinguish them from T-even phages. Before being physically referred to ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7  TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and trans ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Yugoslav Torpedo Boat T7
''T7'' was a sea-going torpedo boat operated by the Royal Yugoslav Navy between 1921 and 1941. Originally ''96 F'', a 250t-class torpedo boat of the Austro-Hungarian Navy built in 1915–1916, she was armed with two guns and four torpedo tubes, and could carry 10–12 naval mines. She saw active service during World War I, performing convoy escort, patrol, and minesweeping tasks, and anti-submarine operations. In 1917 the suffixes of all Austro-Hungarian torpedo boats were removed, and thereafter she was referred to as ''96''. Following Austria-Hungary's defeat in 1918, ''96'' was allocated to the Navy of the Kingdom of Serbs, Croats and Slovenes, which later became the Royal Yugoslav Navy, and was renamed ''T7''. At the time, she and the seven other 250t-class boats were the only modern sea-going vessels of the fledgling maritime force. During the interwar period, ''T7'' and the rest of the navy were involved in training exercises and cruises to friendly ports, but activit ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
LSWR T7 Class
The LSWR Class T7 4-2-2-0 was a prototype express steam locomotive design by Dugald Drummond for the London and South Western Railway introduced in 1897. Five similar locomotives, classified E10, were introduced in 1901. Background Number 720 was a prototype locomotive built in 1897 and classified T7. The layout was unusual and influenced by Francis Webb's 3-cylinder compound locomotives introduced in 1883 on the London and North Western Railway (LNWR) that employed two pairs of uncoupled driving wheels; the Drummond locomotives were always known as the "double singles". Five similar locomotives, numbers 369-373, were built in 1901 and classified E10. Design features Throughout locomotive history, this type of layout with independent uncoupled trains of driving wheels mounted on a common rigid chassis has been repeatedly tried with various aims in mind (the best-known more recent example is the Duplex locomotive). Aims In the case of Drummond, the main motive appears to ha ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Olympic Park Line
The Olympic Park railway line is a railway line linking the Sydney Olympic Park precinct to the Main Suburban railway line at Flemington and Lidcombe. Originally opened as the Abattoirs branch in 1911, it was rebuilt and reopened as the Olympic Park railway line in 1998. Passenger services have since been running on it as the Olympic Park Line (numbered T7, grey). History Abattoirs branch The line opened on 31 July 1911 as the Abattoirs branch off the Main Suburban railway line to the abattoirs and State Brickworks at Homebush Bay (now Sydney Olympic Park). It branched off via a triangular junction behind Flemington Maintenance Depot making it accessible from the Metropolitan Goods line."Forgotten Railways to the Olympic Site" ''Australian Railway Historical Society Bulletin'' issue 737 March 1999 pages 87–96 Two bridges carried the line over the Great Western Highway. On 11 January 1915, the Metropolitan Meat Platforms opened. Further platforms opened at Abattoirs in ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
T7 Bristol–Chepstow
The T7 is a bus service which operates between Bristol and Chepstow with a limited service to Magor. It is part of the TrawsCymru network. History The service was introduced as a partial replacement for the Severn Express, which was withdrawn after 14 June 2020. It began operating on 15 June 2020 on a six-month trial basis and was initially numbered X7. It operated during weekdays only and was operated by NAT Group. Following a tendering process, the route passed from NAT Group to Newport Bus in January 2021. At this time, the route was also renumbered T7 and it began running seven days per week. From 1 November 2021, Newport Bus started funding a third vehicle on the route in an attempt to improve service reliability. On 30 January 2022, journeys were allowed more time in response to congestion. The following month, the Welsh Government pledged to fund the third vehicle. Route The route runs at an hourly frequency from Monday to Saturday, and runs four times in each direc ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Tekken 7
is a 2015 fighting game developed and published by Bandai Namco Entertainment. It is the seventh main and ninth overall installment in the ''Tekken'' series, and is the first in that series to be released for PC. ''Tekken 7'' was released to Amusement arcade, arcades in March 2015. An updated arcade version, ''Tekken 7: Fated Retribution'', was released in July 2016, and features expanded content including new stages, costumes, items and characters. The home versions released for PlayStation 4, Windows, and Xbox One in June 2017 were based on ''Fated Retribution''. Set shortly after the events of ''Tekken 6'', the plot focuses on the events leading up to the final battle between martial artist Heihachi Mishima and his son, Kazuya Mishima, Kazuya. ''Tekken 7'' introduces several new elements to the fighting system, such as Rage Arts and the Power Crush mechanic, making the game more beginner friendly than previous iterations in the series. ''Tekken 7'' was a critical and commerci ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
4-2-2-0
Under the Whyte notation for the classification of steam locomotives, 4-2-2-0 represents the wheel arrangement of four leading wheels on two axles, four independently driven driving wheels on two axles, and no trailing wheels. The arrangement became known as ''double single''. Usage This unusual wheel arrangement was first used 1884 by Francis Webb in LNWR No. 3026, a 3-cylinder rebuild of a Metropolitan 4-4-0 Tank engine. In 1893, the arrangement was used by the British engineer Frederick Charles Winby for the locomotive ''James Toleman'', built by Hawthorn Leslie & Company in Britain. It was exhibited at the World's Columbian Exposition in Chicago and then delivered to the Milwaukee Road. Between 1897 and 1901 Dugald Drummond of the London and South Western Railway used this wheel arrangement on two classes of divided drive locomotives, the T7 and E10 classes. The absence of coupling rods A coupling is a device used to connect two shafts together at their ends for ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
ÃŽle-de-France Tramway Line 7
ÃŽle-de-France tramway Line 7 (usually called simply T7) is part of the modern Tramways in ÃŽle-de-France, tram network of the ÃŽle-de-France region of France. Line T7 runs between ''Villejuif – Louis Aragon (Paris Métro), Villejuif – Louis Aragon'' in Villejuif (where it connects to the Paris Métro) and ''Porte de l'Essonne'' in Athis-Mons, south of Paris. It also serves Orly Airport, Paris Orly Airport. The line has a length of and 18 stations. It opened to the public on 16 November 2013. The line is operated by the RATP Group under contract with ÃŽle-de-France Mobilités. Projects Extension to Juvisy-sur-Orge An extension of Line T7 from its current terminus at Athis-Mons to Gare de Juvisy, Juvisy station at Juvisy-sur-Orge is currently at the planning stage. The extension would be long and have six new stations. Notes and references {{DEFAULTSORT:Ile-de-France tramway Line 7 Tram lines in ÃŽle-de-France, Line 7 ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
OS T1000
T1000 and T1300 were two rapid transit train classes used on Oslo Metro in Oslo, Norway. The 197 cars were built by Strømmens Verksted, Norsk Elektrisk & Brown Boveri and AEG between 1960 and 1981. They were the first metro trains used in Oslo, and had remained in active use until being replaced by OS MX3000 trains in 2007. Each car was equipped with a driver's cab at one or both ends and four motors, each with . The cars were long, wide and tall. The trains used 750 V current, and were capable of . Signaling was provided through automatic train protection. In 1960, two less powerful T single-car units were built, designed to be prototypes used on the Oslo Tramway. After a one-year trial, they were put into scheduled traffic to the KolsÃ¥s Line, where they remained in regular service until 1983. The production series was somewhat different in design and performance. T1000 was both used to refer to the class as a whole, or the first 162 cars, that are only equipped with t ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Thoracic Vertebra 7
In vertebrates, thoracic vertebrae compose the middle segment of the vertebral column, between the cervical vertebrae and the lumbar vertebrae. In humans, there are twelve thoracic vertebra (anatomy), vertebrae of intermediate size between the cervical and lumbar vertebrae; they increase in size going towards the lumbar vertebrae. They are distinguished by the presence of Zygapophysial joint, facets on the sides of the bodies for Articulation (anatomy), articulation with the head of rib, heads of the ribs, as well as facets on the transverse processes of all, except the eleventh and twelfth, for articulation with the tubercle (rib), tubercles of the ribs. By convention, the human thoracic vertebrae are numbered T1–T12, with the first one (T1) located closest to the skull and the others going down the spine toward the lumbar region. General characteristics These are the general characteristics of the second through eighth thoracic vertebrae. The first and ninth through twelfth v ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
T7 Road (Tanzania)
The T7 is a Trunk road in Tanzania. The road runs from the city center of Dar es Salaam at the Kamata Intersection, south along the Indian Ocean to Lindi. The road then extends an additional to Mingoyo, where the road connects to the T6 road. The roads as it is approximately . The road is entirely paved. See also * Transport in Tanzania Tanzania’s transport system comprises road, rail, air, and maritime infrastructure, serving both domestic mobility and international trade through key ports like Dar es Salaam . The road network is long, of which is classified as trunk road and ... * List of roads in Tanzania References {{Tanzania-road-stub Roads in Tanzania ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |