HOME





NASBA (molecular Biology)
Nucleic acid sequence-based amplification, commonly referred to as NASBA, is a method in molecular biology which is used to produce multiple copies of single stranded RNA. NASBA is a two-step process that takes RNA and anneals specially designed primers, then utilizes an enzyme cocktail to amplify it. Background Nucleic acid amplification is a technique used to produce several copies of a specific segment of RNA/DNA. Amplified RNA and DNA can be used for a variety of applications, such as genotyping, sequencing, and detection of bacteria or viruses. There are two different types of amplification, non-isothermal and isothermal. Non-isothermal amplification produces multiple copies of RNA/DNA through reiterative cycling between different temperatures. Isothermal amplification produces multiple copies of RNA/DNA at a constant reaction temperature. NASBA takes single stranded RNA, anneals primers to it at 65°C, and then amplifies it at 41°C to produce multiple copies of single strand ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Molecular Biology
Molecular biology is a branch of biology that seeks to understand the molecule, molecular basis of biological activity in and between Cell (biology), cells, including biomolecule, biomolecular synthesis, modification, mechanisms, and interactions. Though cells and other microscopic structures had been observed in living organisms as early as the 18th century, a detailed understanding of the mechanisms and interactions governing their behavior did not emerge until the 20th century, when technologies used in physics and chemistry had advanced sufficiently to permit their application in the biological sciences. The term 'molecular biology' was first used in 1945 by the English physicist William Astbury, who described it as an approach focused on discerning the underpinnings of biological phenomena—i.e. uncovering the physical and chemical structures and properties of biological molecules, as well as their interactions with other molecules and how these interactions explain observ ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Loop-mediated Isothermal Amplification
Loop-mediated isothermal amplification (LAMP) is a single-tube technique for the amplification of DNA for diagnostic purposes and a low-cost alternative to detect certain diseases. LAMP is an isothermal nucleic acid amplification technique. In contrast to the polymerase chain reaction (PCR) technology, in which the reaction is carried out with a series of alternating temperature steps or cycles, isothermal amplification is carried out at a constant temperature, and does not require a thermal cycler. LAMP was invented in 1998 by Eiken Chemical Company in Tokyo.M. Soroka, B. Wasowicz, A. Rymaszewska: ''Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR?'' In: ''Cells.'' Volume 10, issue 8, July 2021, p. , , PMID 34440699, . Reverse transcription loop-mediated isothermal amplification (RT-LAMP) combines LAMP with a reverse transcription step to allow the detection of RNA. __TOC__ Amplification In LAMP, the target sequence is amplified at a constant ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Polymerase Chain Reaction
The polymerase chain reaction (PCR) is a method widely used to make millions to billions of copies of a specific DNA sample rapidly, allowing scientists to amplify a very small sample of DNA (or a part of it) sufficiently to enable detailed study. PCR was invented in 1983 by American biochemist Kary Mullis at Cetus Corporation. Mullis and biochemist Michael Smith (chemist), Michael Smith, who had developed other essential ways of manipulating DNA, were jointly awarded the Nobel Prize in Chemistry in 1993. PCR is fundamental to many of the procedures used in genetic testing and research, including analysis of Ancient DNA, ancient samples of DNA and identification of infectious agents. Using PCR, copies of very small amounts of DNA sequences are exponentially amplified in a series of cycles of temperature changes. PCR is now a common and often indispensable technique used in medical laboratory research for a broad variety of applications including biomedical research and forensic ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Reverse Transcriptase
A reverse transcriptase (RT) is an enzyme used to convert RNA genome to DNA, a process termed reverse transcription. Reverse transcriptases are used by viruses such as HIV and hepatitis B to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, and by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes. The process does not violate the flows of genetic information as described by the classical central dogma, but rather expands it to include transfers of information from RNA to DNA. Retroviral RT has three sequential biochemical activities: RNA-dependent DNA polymerase activity, ribonuclease H (RNase H), and DNA-dependent DNA polymerase activity. Collectively, these activities enable the enzyme to convert single-stranded RNA into double-stranded cDNA. In retroviruses and retrotransposons, this cDNA can then integrate into the host genome, from which new RNA copies can be made via host-cell ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Complementary DNA
In genetics, complementary DNA (cDNA) is DNA that was reverse transcribed (via reverse transcriptase) from an RNA (e.g., messenger RNA or microRNA). cDNA exists in both single-stranded and double-stranded forms and in both natural and engineered forms. In engineered forms, it often is a copy (replicate) of the naturally occurring DNA from any particular organism's natural genome; the organism's own mRNA was naturally transcribed from its DNA, and the cDNA is reverse transcribed from the mRNA, yielding a duplicate of the original DNA. Engineered cDNA is often used to express a specific protein in a cell that does not normally express that protein (i.e., heterologous expression), or to sequence or quantify mRNA molecules using DNA based methods (qPCR, RNA-seq). cDNA that codes for a specific protein can be transferred to a recipient cell for expression as part of recombinant DNA, often bacterial or yeast expression systems. cDNA is also generated to analyze transcriptomic pr ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


Upstream And Downstream (DNA)
In molecular biology and genetics, upstream and downstream both refer to relative positions of genetic code in DNA or RNA. Each strand of DNA or RNA has a 5' end and a 3' end, so named for the carbon position on the deoxyribose (or ribose) ring. By convention, upstream and downstream relate to the 5' to 3' direction respectively in which RNA transcription takes place. Upstream is toward the 5' end of the RNA molecule, and downstream is toward the 3' end. When considering double-stranded DNA, upstream is toward the 5' end of the coding strand for the gene in question and downstream is toward the 3' end. Due to the anti-parallel nature of DNA, this means the 3' end of the template strand is upstream of the gene and the 5' end is downstream. Some genes on the same DNA molecule may be transcribed in opposite directions. This means the upstream and downstream areas of the molecule may change depending on which gene is used as the reference. The terms upstream and downstream are ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

RNAse H
Ribonuclease H (abbreviated RNase H or RNH) is a family of non-nucleotide sequence, sequence-specific endonuclease enzymes that catalysis, catalyze the cleavage of RNA in an RNA/DNA substrate (chemistry), substrate via a hydrolysis, hydrolytic chemical mechanism, mechanism. Members of the RNase H family can be found in nearly all organisms, from bacteria to archaea to eukaryotes. The family is divided into evolutionarily related groups with slightly different substrate (chemistry), substrate preferences, broadly designated ribonuclease H1 and H2. The human genome encodes both H1 and H2. Human ribonuclease H2 is a heterotrimeric complex composed of three subunits, mutations in any of which are among the genetic causes of a rare disease known as Aicardi–Goutières syndrome. A third type, closely related to H2, is found only in a few prokaryotes, whereas H1 and H2 occur in all domains of life. Additionally, RNase H1-like retroviral ribonuclease H domains occur in multidomain reve ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7   TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and trans ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Foot-and-mouth Disease
Foot-and-mouth disease (FMD) or hoof-and-mouth disease (HMD) is an infectious disease, infectious and sometimes fatal virus (biology), viral disease that primarily affects even-toed ungulates, including domestic and wild Bovidae, bovids. The virus causes a high fever lasting two to six days, followed by vesicle (dermatology), blisters inside the mouth and near the hoof that may rupture and cause lameness. FMD has very severe implications for animal farming, since it is highly infectious and can be spread by infected animals comparatively easily through contact with contaminated farming equipment, vehicles, clothing, and feed, and by domestic and wild predators. Its containment demands considerable efforts in vaccine, vaccination, strict monitoring, trade restrictions, quarantines, and the culling of both infected and healthy (uninfected) animals. Susceptible animals include cattle, domestic water buffalo, water buffalo, domestic sheep, sheep, goats, pigs, antelope, deer, and b ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

SARS Coronavirus
Severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1), previously known as severe acute respiratory syndrome coronavirus (SARS-CoV), is a strain of coronavirus that causes severe acute respiratory syndrome (SARS), the respiratory illness responsible for the 2002–2004 SARS outbreak. It is an enveloped, positive-sense, single-stranded RNA virus that infects the epithelial cells within the lungs. The virus enters the host cell by binding to angiotensin-converting enzyme 2. It infects humans, bats, and palm civets. The SARS-CoV-1 outbreak was largely brought under control by simple public health measures. Testing people with symptoms (fever and respiratory problems), isolating and quarantining suspected cases, and restricting travel all had an effect. SARS-CoV-1 was most transmissible when patients were sick, so its spread could be effectively suppressed by isolating patients with symptoms. On April 16, 2003, following the outbreak of SARS in Asia and secondary c ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

SARS
Severe acute respiratory syndrome (SARS) is a viral respiratory disease of zoonotic origin caused by the virus SARS-CoV-1, the first identified strain of the SARS-related coronavirus. The first known cases occurred in November 2002, and the syndrome caused the 2002–2004 SARS outbreak. In 2004, Xue Wu Zhang and Yee Leng Yap found that the Spike 2 (S2) protein of SARS is structurally similar to HIV-1 gp41 subunit, suggesting an analogous membrane fusion mechanism between the two. In the 2010s, Chinese scientists traced the virus through the intermediary of Asian palm civets to cave-dwelling horseshoe bats in Xiyang Yi Ethnic Township, Yunnan.The locality was referred to be "a cave in Kunming" in earlier sources because the Xiyang Yi Ethnic Township is administratively part of Kunming, though 70 km apart. Xiyang was identified on * For an earlier interview of the researchers about the locality of the caves, see: SARS was a relatively rare disease; at the end of the ep ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Coronavirus
Coronaviruses are a group of related RNA viruses that cause diseases in mammals and birds. In humans and birds, they cause respiratory tract infections that can range from mild to lethal. Mild illnesses in humans include some cases of the common cold (which is also caused by other viruses, predominantly rhinoviruses), while more lethal varieties can cause SARS, MERS and COVID-19. In cows and pigs they cause diarrhea, while in mice they cause hepatitis and encephalomyelitis. Coronaviruses constitute the subfamily ''Orthocoronavirinae'', in the family ''Coronaviridae'', order ''Nidovirales'' and realm ''Riboviria''. They are enveloped viruses with a Positive-strand RNA virus, positive-sense single-stranded RNA genome and a nucleocapsid of helical symmetry. The genome size of coronaviruses ranges from approximately 26 to 32 kilobases, one of the largest among RNA viruses. They have characteristic club-shaped Spike protein, spikes that project from their surface, which in electron ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]