HOME



picture info

Operons
In genetics, an operon is a functioning unit of DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo splicing to create monocistronic mRNAs that are translated separately, i.e. several strands of mRNA that each encode a single gene product. The result of this is that the genes contained in the operon are either expressed together or not at all. Several genes must be ''co-transcribed'' to define an operon. Originally, operons were thought to exist solely in prokaryotes (which includes organelles like plastids that are derived from bacteria), but their discovery in eukaryotes was shown in the early 1990s, and are considered to be rare. In general, expression of prokaryotic operons leads to the generation of polycistronic mRNAs, while eukaryotic operons lead to monocistronic mRNAs. Operons are also found in viruses such as bacteriophages. For ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Operator (biology)
In genetics, an operon is a functioning unit of DNA containing a cluster of genes under the control of a single promoter (genetics), promoter. The genes are transcription (biology), transcribed together into an Messenger RNA, mRNA strand and either translation (biology), translated together in the cytoplasm, or undergo RNA splicing, splicing to create Cistron, monocistronic mRNAs that are translated separately, i.e. several strands of mRNA that each encode a single gene product. The result of this is that the genes contained in the operon are either gene expression, expressed together or not at all. Several genes must be ''co-transcribed'' to define an operon. Originally, operons were thought to exist solely in prokaryotes (which includes organelles like plastids that are derived from bacteria), but their discovery in eukaryotes was shown in the early 1990s, and are considered to be rare. In general, expression of prokaryotic operons leads to the generation of Cistron, polycistron ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Gene
In biology, the word gene has two meanings. The Mendelian gene is a basic unit of heredity. The molecular gene is a sequence of nucleotides in DNA that is transcribed to produce a functional RNA. There are two types of molecular genes: protein-coding genes and non-coding genes. During gene expression (the synthesis of Gene product, RNA or protein from a gene), DNA is first transcription (biology), copied into RNA. RNA can be non-coding RNA, directly functional or be the intermediate protein biosynthesis, template for the synthesis of a protein. The transmission of genes to an organism's offspring, is the basis of the inheritance of phenotypic traits from one generation to the next. These genes make up different DNA sequences, together called a genotype, that is specific to every given individual, within the gene pool of the population (biology), population of a given species. The genotype, along with environmental and developmental factors, ultimately determines the phenotype ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Caenorhabditis Elegans
''Caenorhabditis elegans'' () is a free-living transparent nematode about 1 mm in length that lives in temperate soil environments. It is the type species of its genus. The name is a Hybrid word, blend of the Greek ''caeno-'' (recent), ''rhabditis'' (rod-like) and Latin ''elegans'' (elegant). In 1900, Émile Maupas, Maupas initially named it ''Rhabditidae, Rhabditides elegans.'' Günther Osche, Osche placed it in the subgenus ''Caenorhabditis'' in 1952, and in 1955, Ellsworth Dougherty, Dougherty raised ''Caenorhabditis'' to the status of genus. ''C. elegans'' is an unsegmented pseudocoelomate and lacks respiratory or circulatory systems. Most of these nematodes are hermaphrodites and a few are males. Males have specialised tails for mating that include spicule (nematode), spicules. In 1963, Sydney Brenner proposed research into ''C. elegans,'' primarily in the area of neuronal development. In 1974, he began research into the molecular biology, molecular and developmental ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  




T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7   TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and trans ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Drosophila
''Drosophila'' (), from Ancient Greek δρόσος (''drósos''), meaning "dew", and φίλος (''phílos''), meaning "loving", is a genus of fly, belonging to the family Drosophilidae, whose members are often called "small fruit flies" or pomace flies, vinegar flies, or wine flies, a reference to the characteristic of many species to linger around overripe or rotting fruit. They should not be confused with the Tephritidae, a related family, which are also called fruit flies (sometimes referred to as "true fruit flies"); tephritids feed primarily on unripe or ripe fruit, with many species being regarded as destructive agricultural pests, especially the Mediterranean fruit fly. One species of ''Drosophila'' in particular, ''Drosophila melanogaster'', has been heavily used in research in genetics and is a common model organism in developmental biology. The terms "fruit fly" and "''Drosophila''" are often used synonymously with ''D. melanogaster'' in modern biological literatur ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Nematode
The nematodes ( or ; ; ), roundworms or eelworms constitute the phylum Nematoda. Species in the phylum inhabit a broad range of environments. Most species are free-living, feeding on microorganisms, but many are parasitic. Parasitic worms (helminths) are the cause of soil-transmitted helminthiases. They are classified along with arthropods, tardigrades and other moulting animals in the clade Ecdysozoa. Unlike the flatworms, nematodes have a tubular digestive system, with openings at both ends. Like tardigrades, they have a reduced number of Hox genes, but their sister phylum Nematomorpha has kept the ancestral protostome Hox genotype, which shows that the reduction has occurred within the nematode phylum. Nematode species can be difficult to distinguish from one another. Consequently, estimates of the number of nematode species are uncertain. A 2013 survey of animal biodiversity suggested there are over 25,000. Estimates of the total number of extant species are su ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


Jacques Monod
Jacques Lucien Monod (; 9 February 1910 – 31 May 1976) was a French biochemist who won the Nobel Prize in Physiology or Medicine in 1965, sharing it with François Jacob and André Lwoff "for their discoveries concerning genetic control of enzyme and virus synthesis".'' Chance and Necessity: An Essay on the Natural Philosophy of Modern Biology'' by Jacques Monod, New York, Alfred A. Knopf, 1971, Monod and Jacob became famous for their work on the '' E. coli'' ''lac'' operon, which encodes proteins necessary for the transport and breakdown of the sugar lactose (lac). From their own work and the work of others, they came up with a model for how the levels of some proteins in a cell are controlled. In their model, the manufacture of a set of related proteins, such as the ones encoded within the ''lac'' (lactose) operon, is prevented when a repressor protein, encoded by a regulatory gene, binds to its operator, a specific site in the DNA sequence that is close to the genes en ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


André Michel Lwoff
André Michel Lwoff (8 May 1902 – 30 September 1994) was a French microbiologist and Nobel laureate. Education, early life and career Lwoff was born in Ainay-le-Château, Allier, in Auvergne, France, into a Jewish family of Russian-Polish origin, the son of Marie (Siminovitch), an artist, and Solomon Lwoff, a psychiatrist. He joined the Institute Pasteur in Paris when he was 19 years old. In 1932, he finished his PhD and, with the help of a grant from the Rockefeller Foundation, moved with his wife and co-researcher Marguerite Lwoff to the Kaiser Wilhelm Institute for Medical Research of Heidelberg to Otto Meyerhof, where he did research on the development of flagellates. Another Rockefeller grant allowed him go to the University of Cambridge in 1937. In 1938, he was appointed departmental head at the Institut Pasteur, where he did groundbreaking research on bacteriophages, microbiota and on the poliovirus. Awards and honors He was awarded numerous prizes from the Fre ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


François Jacob
François Jacob (; 17 June 1920 – 19 April 2013) was a French biologist who, together with Jacques Monod, originated the idea that control of enzyme levels in all cells occurs through regulation of transcription. He shared the 1965 Nobel Prize in Medicine with Jacques Monod and André Lwoff. Early years Jacob was born the only child of Simon, a merchant, and Thérèse (Franck) Jacob, in Nancy, France. An inquisitive child, he learned to read at a young age. Albert Franck, Jacob's maternal grandfather, a four-star general, was Jacob's childhood role model. At seven he entered the Lycée Carnot, where he was schooled for the next ten years; in his autobiography, he describes his impression of it: "a cage". He was antagonized by rightist youth at the Lycée Carnot around 1934. He describes his father as a "conformist in religion", while his mother and other family members important in his childhood were secular Jews; shortly after his bar mitzvah, he became an athe ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Nobel Prize In Physiology And Medicine
The Nobel Prize in Physiology or Medicine () is awarded yearly by the Nobel Assembly at the Karolinska Institute, Nobel Assembly at the Karolinska Institute for outstanding discoveries in physiology or medicine. The Nobel Prize is not a single prize, but five separate prizes that, according to Alfred Nobel's 1895 will, are awarded "to those who, during the preceding year, have conferred the greatest benefit to humankind". Nobel Prizes are awarded in the fields of Nobel Prize in Physics, Physics, Medicine or Physiology, Nobel Prize in Chemistry, Chemistry, Nobel Prize in Literature, Literature, and Nobel Peace Prize, Peace. The Nobel Prize is presented annually on the anniversary of Alfred Nobel's death, 10 December. As of 2024, 115 Nobel Prizes in Physiology or Medicine have been awarded to 229 laureates, 216 men and 13 women. The first one was awarded in 1901 to the German physiologist, Emil von Behring, for his work on blood plasma, serum therapy and the development of a vacci ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]  


picture info

Escherichia Coli
''Escherichia coli'' ( )Wells, J. C. (2000) Longman Pronunciation Dictionary. Harlow ngland Pearson Education Ltd. is a gram-negative, facultative anaerobic, rod-shaped, coliform bacterium of the genus '' Escherichia'' that is commonly found in the lower intestine of warm-blooded organisms. Most ''E. coli'' strains are part of the normal microbiota of the gut, where they constitute about 0.1%, along with other facultative anaerobes. These bacteria are mostly harmless or even beneficial to humans. For example, some strains of ''E. coli'' benefit their hosts by producing vitamin K2 or by preventing the colonization of the intestine by harmful pathogenic bacteria. These mutually beneficial relationships between ''E. coli'' and humans are a type of mutualistic biological relationship—where both the humans and the ''E. coli'' are benefitting each other. ''E. coli'' is expelled into the environment within fecal matter. The bacterium grows massi ...
[...More Info...]      
[...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]